EMAIL THIS PAGE TO A FRIEND

ZNF618

zinc finger protein 618

Synonyms: FP13169 NEDD10
Gene ID:
Zebrafish(323343) zinc finger protein 618
Zebrafish(100330008) zinc finger protein 618
chicken(770984) zinc finger protein 618
Horse(100051828) zinc finger protein 618
domestic cat(101098015) zinc finger protein 618
dog(474809) zinc finger protein 618
cow(528603) zinc finger protein 618
sheep(101104458) zinc finger protein 618
domestic guinea pig(100714353) zinc finger protein 618
naked mole-rat(101696865) zinc finger protein 618
Domestic Rabbit(100356398) zinc finger protein 618
164 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133374 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133374 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133374 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082971 MISSION® esiRNA esiRNA human ZNF618 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133374 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363077 predicted 918
2 SASI_Hs02_00363078 predicted 560
3 SASI_Hs02_00363079 predicted 910
4 SASI_Hs02_00363080 predicted 823
5 SASI_Hs01_00135430 predicted 1353
6 SASI_Hs01_00135433 predicted 1506
7 SASI_Hs02_00363081 predicted 2044
8 SASI_Hs01_00135436 predicted 1912
9 SASI_Hs02_00363082 predicted 553
10 SASI_Hs01_00135438 predicted 2410
11 SASI_Hs01_00135429 predicted 1909
12 SASI_Hs01_00135431 predicted 1448
13 SASI_Hs01_00135432 predicted 2231
14 SASI_Hs01_00135434 predicted 2636
15 SASI_Hs01_00135435 predicted 1686
16 SASI_Hs01_00135437 predicted 2321
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133374
ZNF618 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 618
Human
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133374.2-539s21c1
Sequence:CCGGGAGCCTCCCAAAGCAACAATTCTCGAGAATTGTTGCTTTGGGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133374.2-1656s21c1
Sequence:CCGGGACAGTGTACGTGACGGATTGCTCGAGCAATCCGTCACGTACACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133374.2-910s21c1
Sequence:CCGGAGCGCTTTCAGTCGGAGAGTACTCGAGTACTCTCCGACTGAAAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133374.2-2595s21c1
Sequence:CCCGGTGTGAACAAGCGCTTCTAATCTCGAGATTAGAAGCGCTTGTTCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133374.2-2635s21c1
Sequence:CCGGAGTCCAGAAGATATGAATAAACTCGAGTTTATTCATATCTTCTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133374.2-3135s21c1
Sequence:CCGGGGTGTGCAGATTGGCAGAAAGCTCGAGCTTTCTGCCAATCTGCACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133374.2-2781s21c1
Sequence:CCGGACACTGTGGACCTCATTATAACTCGAGTTATAATGAGGTCCACAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133374.2-1625s21c1
Sequence:CCGGTGCTGTCGGAGTTCGTGATGTCTCGAGACATCACGAACTCCGACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133374.2-429s21c1
Sequence:CCGGGACCCTTGGGTCTTACGAATGCTCGAGCATTCGTAAGACCCAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133374.2-3051s21c1
Sequence:CCGGGTCAGGAAAGCTGAGCGATTGCTCGAGCAATCGCTCAGCTTTCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133374.1-2254s1c1
Sequence:CCGGGCCAAGAAGATGAACCTCATCCTCGAGGATGAGGTTCATCTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133374.1-2478s1c1
Sequence:CCGGCAAGGAGAACTTCAAGGTGCACTCGAGTGCACCTTGAAGTTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133374.1-2475s1c1
Sequence:CCGGGCTCAAGGAGAACTTCAAGGTCTCGAGACCTTGAAGTTCTCCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133374.1-2695s1c1
Sequence:CCGGGAAGATGATCGGCTAGGCAAACTCGAGTTTGCCTAGCCGATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133374.1-1833s1c1
Sequence:CCGGGAGCTATGTGCTTGGTGTGAACTCGAGTTCACACCAAGCACATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133374.1-1825s1c1
Sequence:CCGGCACATCAAGAGCTATGTGCTTCTCGAGAAGCACATAGCTCTTGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133374.1-1830s1c1
Sequence:CCGGCAAGAGCTATGTGCTTGGTGTCTCGAGACACCAAGCACATAGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133374.1-1441s1c1
Sequence:CCGGGCCAATAACACCACTACCAGTCTCGAGACTGGTAGTGGTGTTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133374.1-1428s1c1
Sequence:CCGGCCAGAGGAACAGTGCCAATAACTCGAGTTATTGGCACTGTTCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133374
ZNF618 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 618
Human
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133374.2-539s21c1
Sequence:CCGGGAGCCTCCCAAAGCAACAATTCTCGAGAATTGTTGCTTTGGGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133374.2-1656s21c1
Sequence:CCGGGACAGTGTACGTGACGGATTGCTCGAGCAATCCGTCACGTACACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133374.2-910s21c1
Sequence:CCGGAGCGCTTTCAGTCGGAGAGTACTCGAGTACTCTCCGACTGAAAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133374.2-2595s21c1
Sequence:CCCGGTGTGAACAAGCGCTTCTAATCTCGAGATTAGAAGCGCTTGTTCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133374.2-2635s21c1
Sequence:CCGGAGTCCAGAAGATATGAATAAACTCGAGTTTATTCATATCTTCTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133374.2-3135s21c1
Sequence:CCGGGGTGTGCAGATTGGCAGAAAGCTCGAGCTTTCTGCCAATCTGCACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133374.2-2781s21c1
Sequence:CCGGACACTGTGGACCTCATTATAACTCGAGTTATAATGAGGTCCACAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133374.2-1625s21c1
Sequence:CCGGTGCTGTCGGAGTTCGTGATGTCTCGAGACATCACGAACTCCGACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133374.2-429s21c1
Sequence:CCGGGACCCTTGGGTCTTACGAATGCTCGAGCATTCGTAAGACCCAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133374.2-3051s21c1
Sequence:CCGGGTCAGGAAAGCTGAGCGATTGCTCGAGCAATCGCTCAGCTTTCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133374.1-2254s1c1
Sequence:CCGGGCCAAGAAGATGAACCTCATCCTCGAGGATGAGGTTCATCTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133374.1-2478s1c1
Sequence:CCGGCAAGGAGAACTTCAAGGTGCACTCGAGTGCACCTTGAAGTTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133374.1-2475s1c1
Sequence:CCGGGCTCAAGGAGAACTTCAAGGTCTCGAGACCTTGAAGTTCTCCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133374.1-2695s1c1
Sequence:CCGGGAAGATGATCGGCTAGGCAAACTCGAGTTTGCCTAGCCGATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133374.1-1833s1c1
Sequence:CCGGGAGCTATGTGCTTGGTGTGAACTCGAGTTCACACCAAGCACATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133374.1-1825s1c1
Sequence:CCGGCACATCAAGAGCTATGTGCTTCTCGAGAAGCACATAGCTCTTGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133374.1-1830s1c1
Sequence:CCGGCAAGAGCTATGTGCTTGGTGTCTCGAGACACCAAGCACATAGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133374.1-1441s1c1
Sequence:CCGGGCCAATAACACCACTACCAGTCTCGAGACTGGTAGTGGTGTTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133374.1-1428s1c1
Sequence:CCGGCCAGAGGAACAGTGCCAATAACTCGAGTTATTGGCACTGTTCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133374
ZNF618 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 618
Human
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133374.2-539s21c1
Sequence:CCGGGAGCCTCCCAAAGCAACAATTCTCGAGAATTGTTGCTTTGGGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133374.2-1656s21c1
Sequence:CCGGGACAGTGTACGTGACGGATTGCTCGAGCAATCCGTCACGTACACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133374.2-910s21c1
Sequence:CCGGAGCGCTTTCAGTCGGAGAGTACTCGAGTACTCTCCGACTGAAAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133374.2-2595s21c1
Sequence:CCCGGTGTGAACAAGCGCTTCTAATCTCGAGATTAGAAGCGCTTGTTCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133374.2-2635s21c1
Sequence:CCGGAGTCCAGAAGATATGAATAAACTCGAGTTTATTCATATCTTCTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133374.2-3135s21c1
Sequence:CCGGGGTGTGCAGATTGGCAGAAAGCTCGAGCTTTCTGCCAATCTGCACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133374.2-2781s21c1
Sequence:CCGGACACTGTGGACCTCATTATAACTCGAGTTATAATGAGGTCCACAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133374.2-1625s21c1
Sequence:CCGGTGCTGTCGGAGTTCGTGATGTCTCGAGACATCACGAACTCCGACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133374.2-429s21c1
Sequence:CCGGGACCCTTGGGTCTTACGAATGCTCGAGCATTCGTAAGACCCAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133374.2-3051s21c1
Sequence:CCGGGTCAGGAAAGCTGAGCGATTGCTCGAGCAATCGCTCAGCTTTCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133374.1-2254s1c1
Sequence:CCGGGCCAAGAAGATGAACCTCATCCTCGAGGATGAGGTTCATCTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133374.1-2478s1c1
Sequence:CCGGCAAGGAGAACTTCAAGGTGCACTCGAGTGCACCTTGAAGTTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133374.1-2475s1c1
Sequence:CCGGGCTCAAGGAGAACTTCAAGGTCTCGAGACCTTGAAGTTCTCCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133374.1-2695s1c1
Sequence:CCGGGAAGATGATCGGCTAGGCAAACTCGAGTTTGCCTAGCCGATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133374.1-1833s1c1
Sequence:CCGGGAGCTATGTGCTTGGTGTGAACTCGAGTTCACACCAAGCACATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133374.1-1825s1c1
Sequence:CCGGCACATCAAGAGCTATGTGCTTCTCGAGAAGCACATAGCTCTTGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133374.1-1830s1c1
Sequence:CCGGCAAGAGCTATGTGCTTGGTGTCTCGAGACACCAAGCACATAGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133374.1-1441s1c1
Sequence:CCGGGCCAATAACACCACTACCAGTCTCGAGACTGGTAGTGGTGTTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133374.1-1428s1c1
Sequence:CCGGCCAGAGGAACAGTGCCAATAACTCGAGTTATTGGCACTGTTCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks