EMAIL THIS PAGE TO A FRIEND

ZNF619

zinc finger protein 619

UniProtKB ID: Q8N2I2, B4E271
Gene ID:
cow(786139) zinc finger protein 619
sheep(101118564) zinc finger protein 619
domestic cat(101083541) zinc finger protein 619
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173656 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173656 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173656 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000771 MISSION® esiRNA esiRNA targeting human ZNF619 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173656 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010936 predicted 835
2 SASI_Hs01_00010937 predicted 1091
3 SASI_Hs02_00368569 predicted 1730
4 SASI_Hs02_00368570 predicted 1726
5 SASI_Hs02_00368571 predicted 853
6 SASI_Hs01_00010939 predicted 859
7 SASI_Hs01_00010942 predicted 827
8 SASI_Hs02_00368572 predicted 1751
9 SASI_Hs01_00010943 predicted 1306
10 SASI_Hs01_00010944 predicted 993
11 SASI_Hs01_00010938 predicted 1508
12 SASI_Hs01_00010940 predicted 979
13 SASI_Hs01_00010941 predicted 1381
14 SASI_Hs01_00010945 predicted 876
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173656
ZNF619 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 619
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173656.1-763s1c1
Sequence:CCGGCAGCTACATGATACAGGGAATCTCGAGATTCCCTGTATCATGTAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173656.1-1964s1c1
Sequence:CCGGCACCTGTCCAAATAGCACATTCTCGAGAATGTGCTATTTGGACAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173656.1-653s1c1
Sequence:CCGGCTGCACAGCTAAACATTTCTACTCGAGTAGAAATGTTTAGCTGTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173656.1-1716s1c1
Sequence:CCGGCTTCAGATGGAATGCAAGTTTCTCGAGAAACTTGCATTCCATCTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173656.1-1478s1c1
Sequence:CCGGCGGTATTTCTTCAGCACCAGACTCGAGTCTGGTGCTGAAGAAATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173656.2-885s21c1
Sequence:CCGGGTGTCAGCACACATCTCATTACTCGAGTAATGAGATGTGTGCTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173656.2-2194s21c1
Sequence:CCGGCACGCTTAAGGACCATGTTTGCTCGAGCAAACATGGTCCTTAAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173656.2-1378s21c1
Sequence:CCGGGAAGAGTTTGAGTTCTAATTCCTCGAGGAATTAGAACTCAAACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173656
ZNF619 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 619
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173656.1-763s1c1
Sequence:CCGGCAGCTACATGATACAGGGAATCTCGAGATTCCCTGTATCATGTAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173656.1-1964s1c1
Sequence:CCGGCACCTGTCCAAATAGCACATTCTCGAGAATGTGCTATTTGGACAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173656.1-653s1c1
Sequence:CCGGCTGCACAGCTAAACATTTCTACTCGAGTAGAAATGTTTAGCTGTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173656.1-1716s1c1
Sequence:CCGGCTTCAGATGGAATGCAAGTTTCTCGAGAAACTTGCATTCCATCTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173656.1-1478s1c1
Sequence:CCGGCGGTATTTCTTCAGCACCAGACTCGAGTCTGGTGCTGAAGAAATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173656.2-885s21c1
Sequence:CCGGGTGTCAGCACACATCTCATTACTCGAGTAATGAGATGTGTGCTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173656.2-2194s21c1
Sequence:CCGGCACGCTTAAGGACCATGTTTGCTCGAGCAAACATGGTCCTTAAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173656.2-1378s21c1
Sequence:CCGGGAAGAGTTTGAGTTCTAATTCCTCGAGGAATTAGAACTCAAACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173656
ZNF619 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 619
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173656.1-763s1c1
Sequence:CCGGCAGCTACATGATACAGGGAATCTCGAGATTCCCTGTATCATGTAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173656.1-1964s1c1
Sequence:CCGGCACCTGTCCAAATAGCACATTCTCGAGAATGTGCTATTTGGACAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173656.1-653s1c1
Sequence:CCGGCTGCACAGCTAAACATTTCTACTCGAGTAGAAATGTTTAGCTGTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173656.1-1716s1c1
Sequence:CCGGCTTCAGATGGAATGCAAGTTTCTCGAGAAACTTGCATTCCATCTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173656.1-1478s1c1
Sequence:CCGGCGGTATTTCTTCAGCACCAGACTCGAGTCTGGTGCTGAAGAAATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173656.2-885s21c1
Sequence:CCGGGTGTCAGCACACATCTCATTACTCGAGTAATGAGATGTGTGCTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173656.2-2194s21c1
Sequence:CCGGCACGCTTAAGGACCATGTTTGCTCGAGCAAACATGGTCCTTAAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173656.2-1378s21c1
Sequence:CCGGGAAGAGTTTGAGTTCTAATTCCTCGAGGAATTAGAACTCAAACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks