EMAIL THIS PAGE TO A FRIEND

ZNF620

zinc finger protein 620

Species: Human ZNF620(253639), domestic cat ZNF620(101083290)
UniProtKB ID: Q6ZNG0, Q8N223
Gene ID:
domestic cat(101083290) zinc finger protein 620
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175888 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175888 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175888 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU031531 MISSION® esiRNA esiRNA human ZNF620 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175888 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140527 predicted 847
2 SASI_Hs01_00140528 predicted 578
3 SASI_Hs01_00140529 predicted 845
4 SASI_Hs01_00140530 predicted 419
5 SASI_Hs01_00140531 predicted 849
6 SASI_Hs01_00140532 predicted 838
7 SASI_Hs01_00140533 predicted 448
8 SASI_Hs01_00140534 predicted 737
9 SASI_Hs01_00140535 predicted 693
10 SASI_Hs01_00140536 predicted 707
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175888
ZNF620 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 620
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175888.1-450s1c1
Sequence:CCGGCCAAAGGATCATGTGTCCAAACTCGAGTTTGGACACATGATCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175888.1-1559s1c1
Sequence:CCGGCCCAACATGAAGTCTCTTTATCTCGAGATAAAGAGACTTCATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175888.1-696s1c1
Sequence:CCGGCTCACTACAAATCAGACAAATCTCGAGATTTGTCTGATTTGTAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175888.1-427s1c1
Sequence:CCGGGAACTGAGAAGGAAGGATTAACTCGAGTTAATCCTTCCTTCTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175888.1-555s1c1
Sequence:CCGGCCACAAGGTCATTGGATAATTCTCGAGAATTATCCAATGACCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175888
ZNF620 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 620
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175888.1-450s1c1
Sequence:CCGGCCAAAGGATCATGTGTCCAAACTCGAGTTTGGACACATGATCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175888.1-1559s1c1
Sequence:CCGGCCCAACATGAAGTCTCTTTATCTCGAGATAAAGAGACTTCATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175888.1-696s1c1
Sequence:CCGGCTCACTACAAATCAGACAAATCTCGAGATTTGTCTGATTTGTAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175888.1-427s1c1
Sequence:CCGGGAACTGAGAAGGAAGGATTAACTCGAGTTAATCCTTCCTTCTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175888.1-555s1c1
Sequence:CCGGCCACAAGGTCATTGGATAATTCTCGAGAATTATCCAATGACCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175888
ZNF620 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 620
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175888.1-450s1c1
Sequence:CCGGCCAAAGGATCATGTGTCCAAACTCGAGTTTGGACACATGATCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175888.1-1559s1c1
Sequence:CCGGCCCAACATGAAGTCTCTTTATCTCGAGATAAAGAGACTTCATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175888.1-696s1c1
Sequence:CCGGCTCACTACAAATCAGACAAATCTCGAGATTTGTCTGATTTGTAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175888.1-427s1c1
Sequence:CCGGGAACTGAGAAGGAAGGATTAACTCGAGTTAATCCTTCCTTCTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175888.1-555s1c1
Sequence:CCGGCCACAAGGTCATTGGATAATTCTCGAGAATTATCCAATGACCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks