EMAIL THIS PAGE TO A FRIEND

ZNF621

zinc finger protein 621

Species: Human ZNF621(285268), domestic cat ZNF621(101097587), cow ZNF621(530346), Domestic Rabbit ZNF621(100353171), domestic guinea pig Znf621(100734189)
UniProtKB ID: Q6ZSS3, Q14DC7, Q8TE91
Gene ID:
domestic cat(101097587) zinc finger protein 621
cow(530346) zinc finger protein 621
Domestic Rabbit(100353171) zinc finger protein 621
domestic guinea pig(100734189) zinc finger protein 621
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198484 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198484 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198484 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065151 MISSION® esiRNA esiRNA human ZNF621 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098414 Rosetta Predictions human pricing
NM_198484 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318879 predicted 788
2 SASI_Hs02_00318880 predicted 567
3 SASI_Hs02_00318881 predicted 444
4 SASI_Hs02_00318882 predicted 603
5 SASI_Hs02_00318883 predicted 691
6 SASI_Hs02_00318884 predicted 574
7 SASI_Hs02_00318885 predicted 527
8 SASI_Hs02_00318886 predicted 616
9 SASI_Hs02_00318887 predicted 693
10 SASI_Hs02_00318888 predicted 632
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198484 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372034 predicted 1025
2 SASI_Hs02_00372035 predicted 808
3 SASI_Hs01_00166444 predicted 682
4 SASI_Hs01_00166445 predicted 837
5 SASI_Hs02_00372036 predicted 928
6 SASI_Hs01_00166446 predicted 806
7 SASI_Hs01_00166447 predicted 764
8 SASI_Hs02_00372037 predicted 854
9 SASI_Hs01_00166449 predicted 929
10 SASI_Hs01_00166450 predicted 867
11 SASI_Hs01_00166448 predicted 688
12 SASI_Hs01_00166451 predicted 1306
13 SASI_Hs01_00166452 predicted 1641
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198484
VALIDATED
ZNF621 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 621
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198484.2-5180s1c1
Sequence:CCGGGCCACCTATTTCTTGTTGTAACTCGAGTTACAACAAGAAATAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198484.2-1136s1c1
Sequence:CCGGCTTTCGGTTGTAGGTCACTTTCTCGAGAAAGTGACCTACAACCGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_198484.2-804s1c1
Sequence:CCGGCCGATATAACTCAAAGCTTATCTCGAGATAAGCTTTGAGTTATATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198484.2-757s1c1
Sequence:CCGGCGAGGTGGAATGAAGTTCTATCTCGAGATAGAACTTCATTCCACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198484.2-1332s1c1
Sequence:CCGGGCATCAGAAATTGCACCCTGTCTCGAGACAGGGTGCAATTTCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198484.3-1610s21c1
Sequence:CCGGTCCACATGCTGTGCTCATTCCCTCGAGGGAATGAGCACAGCATGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198484.3-1807s21c1
Sequence:CCGGAGCAAATCTCCAGCCTAATTTCTCGAGAAATTAGGCTGGAGATTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198484.3-2212s21c1
Sequence:CCGGTACATTTAAAGACCGTGTTTACTCGAGTAAACACGGTCTTTAAATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198484.3-1013s21c1
Sequence:CCGGTTTCAAGTCCAGCTATGATTGCTCGAGCAATCATAGCTGGACTTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198484.3-797s21c1
Sequence:CCGGAGGACTTCTCAGGAACGTTTCCTCGAGGAAACGTTCCTGAGAAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198484.3-848s21c1
Sequence:CCGGGAAGCAGACTTTCAATCTAAACTCGAGTTTAGATTGAAAGTCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198484.3-505s21c1
Sequence:CCGGTTTACTTCACCCAGAATCAATCTCGAGATTGATTCTGGGTGAAGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198484.3-1674s21c1
Sequence:CCGGCCTTCTTCATCTGCCCAAATACTCGAGTATTTGGGCAGATGAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198484.3-1699s21c1
Sequence:CCGGGTGTCTTCCAGGGTCTTACTCCTCGAGGAGTAAGACCCTGGAAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198484
VALIDATED
ZNF621 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 621
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198484.2-5180s1c1
Sequence:CCGGGCCACCTATTTCTTGTTGTAACTCGAGTTACAACAAGAAATAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198484.2-1136s1c1
Sequence:CCGGCTTTCGGTTGTAGGTCACTTTCTCGAGAAAGTGACCTACAACCGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_198484.2-804s1c1
Sequence:CCGGCCGATATAACTCAAAGCTTATCTCGAGATAAGCTTTGAGTTATATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198484.2-757s1c1
Sequence:CCGGCGAGGTGGAATGAAGTTCTATCTCGAGATAGAACTTCATTCCACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198484.2-1332s1c1
Sequence:CCGGGCATCAGAAATTGCACCCTGTCTCGAGACAGGGTGCAATTTCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198484.3-1610s21c1
Sequence:CCGGTCCACATGCTGTGCTCATTCCCTCGAGGGAATGAGCACAGCATGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198484.3-1807s21c1
Sequence:CCGGAGCAAATCTCCAGCCTAATTTCTCGAGAAATTAGGCTGGAGATTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198484.3-2212s21c1
Sequence:CCGGTACATTTAAAGACCGTGTTTACTCGAGTAAACACGGTCTTTAAATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198484.3-1013s21c1
Sequence:CCGGTTTCAAGTCCAGCTATGATTGCTCGAGCAATCATAGCTGGACTTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198484.3-797s21c1
Sequence:CCGGAGGACTTCTCAGGAACGTTTCCTCGAGGAAACGTTCCTGAGAAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198484.3-848s21c1
Sequence:CCGGGAAGCAGACTTTCAATCTAAACTCGAGTTTAGATTGAAAGTCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198484.3-505s21c1
Sequence:CCGGTTTACTTCACCCAGAATCAATCTCGAGATTGATTCTGGGTGAAGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198484.3-1674s21c1
Sequence:CCGGCCTTCTTCATCTGCCCAAATACTCGAGTATTTGGGCAGATGAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198484.3-1699s21c1
Sequence:CCGGGTGTCTTCCAGGGTCTTACTCCTCGAGGAGTAAGACCCTGGAAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198484
VALIDATED
ZNF621 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 621
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198484.2-5180s1c1
Sequence:CCGGGCCACCTATTTCTTGTTGTAACTCGAGTTACAACAAGAAATAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198484.2-1136s1c1
Sequence:CCGGCTTTCGGTTGTAGGTCACTTTCTCGAGAAAGTGACCTACAACCGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_198484.2-804s1c1
Sequence:CCGGCCGATATAACTCAAAGCTTATCTCGAGATAAGCTTTGAGTTATATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198484.2-757s1c1
Sequence:CCGGCGAGGTGGAATGAAGTTCTATCTCGAGATAGAACTTCATTCCACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198484.2-1332s1c1
Sequence:CCGGGCATCAGAAATTGCACCCTGTCTCGAGACAGGGTGCAATTTCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198484.3-1610s21c1
Sequence:CCGGTCCACATGCTGTGCTCATTCCCTCGAGGGAATGAGCACAGCATGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198484.3-1807s21c1
Sequence:CCGGAGCAAATCTCCAGCCTAATTTCTCGAGAAATTAGGCTGGAGATTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198484.3-2212s21c1
Sequence:CCGGTACATTTAAAGACCGTGTTTACTCGAGTAAACACGGTCTTTAAATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198484.3-1013s21c1
Sequence:CCGGTTTCAAGTCCAGCTATGATTGCTCGAGCAATCATAGCTGGACTTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198484.3-797s21c1
Sequence:CCGGAGGACTTCTCAGGAACGTTTCCTCGAGGAAACGTTCCTGAGAAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198484.3-848s21c1
Sequence:CCGGGAAGCAGACTTTCAATCTAAACTCGAGTTTAGATTGAAAGTCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198484.3-505s21c1
Sequence:CCGGTTTACTTCACCCAGAATCAATCTCGAGATTGATTCTGGGTGAAGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198484.3-1674s21c1
Sequence:CCGGCCTTCTTCATCTGCCCAAATACTCGAGTATTTGGGCAGATGAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198484.3-1699s21c1
Sequence:CCGGGTGTCTTCCAGGGTCTTACTCCTCGAGGAGTAAGACCCTGGAAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks