EMAIL THIS PAGE TO A FRIEND

ZNF622

zinc finger protein 622

Synonyms: ZPR9
UniProtKB ID: Q969S3
Gene ID:
domestic guinea pig(100734797) zinc finger protein 622
Domestic Rabbit(100345082) zinc finger protein 622
naked mole-rat(101701813) zinc finger protein 622
cow(513617) zinc finger protein 622
sheep(101102424) zinc finger protein 622
Zebrafish(407703) zinc finger protein 622
Horse(100069990) zinc finger protein 622
domestic cat(101087970) zinc finger protein 622
dog(479383) zinc finger protein 622
chicken(373921) zinc finger protein 622
36 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033414 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033414 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033414 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037541 MISSION® esiRNA esiRNA human ZNF622 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033414 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094540 predicted 1456
2 SASI_Hs01_00094542 predicted 927
3 SASI_Hs01_00094544 predicted 1452
4 SASI_Hs01_00094546 predicted 1443
5 SASI_Hs01_00094548 predicted 922
6 SASI_Hs01_00094549 predicted 328
7 SASI_Hs02_00361307 predicted 1306
8 SASI_Hs02_00361308 predicted 1121
9 SASI_Hs02_00361309 predicted 950
10 SASI_Hs01_00094541 predicted 204
11 SASI_Hs01_00094543 predicted 1428
12 SASI_Hs01_00094545 predicted 863
13 SASI_Hs01_00094547 predicted 896
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033414
VALIDATED
ZNF622 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 622
Human
20 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033414.2-1513s21c1
Sequence:CCGGGCCACCAAGCAGATGCACTTTCTCGAGAAAGTGCATCTGCTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033414.2-666s21c1
Sequence:CCGGGTTTGAACAGCAGGCGAAGAACTCGAGTTCTTCGCCTGCTGTTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033414.2-415s21c1
Sequence:CCGGGTGCAGGCAGTGAATCGGAAACTCGAGTTTCCGATTCACTGCCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033414.2-920s21c1
Sequence:CCAGATGTGGCTCACATGACCAAAGCTCGAGCTTTGGTCATGTGAGCCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033414.2-979s21c1
Sequence:CCGGGATATTAAGGGACTGATTAAACTCGAGTTTAATCAGTCCCTTAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033414.2-1014s21c1
Sequence:CCGGAGTTGGTGTTGGCAAGATTTGCTCGAGCAAATCTTGCCAACACCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033414.2-1170s21c1
Sequence:CCGGGAGTAGCTATCCAGATCACAACTCGAGTTGTGATCTGGATAGCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033414.2-1254s21c1
Sequence:CCGGTGAAACCATGGAATTGATTCTCTCGAGAGAATCAATTCCATGGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033414.2-1044s1c1
Sequence:CCGGCAACGAGAAAGGGAAGTCCTTCTCGAGAAGGACTTCCCTTTCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033414.2-1311s1c1
Sequence:CCGGGAGATACTACAAACAGCGATTCTCGAGAATCGCTGTTTGTAGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033414.2-769s1c1
Sequence:CCGGGAAGAATTGGAATGTGAGGATCTCGAGATCCTCACATTCCAATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033414.2-1456s1c1
Sequence:CCGGCAGTATGTCCAAAGGATGAAACTCGAGTTTCATCCTTTGGACATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033414.2-943s1c1
Sequence:CCGGCACAGTTTCTTTATTCCTGATCTCGAGATCAGGAATAAAGAAACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033414.2-1084s1c1
Sequence:CCGGCAGGCACATATGAATGACAAACTCGAGTTTGTCATTCATATGTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033414.2-1485s1c1
Sequence:CCGGGATGCTGAAGACAGGAATGAACTCGAGTTCATTCCTGTCTTCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033414.2-426s1c1
Sequence:CCGGGAATCGGAAAGTGGAGATGATCTCGAGATCATCTCCACTTTCCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033414.2-1447s1c1
Sequence:CCGGCGAGACATGCAGTATGTCCAACTCGAGTTGGACATACTGCATGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033414.2-335s1c1
Sequence:CCGGGCAGTAAGAAGTTTGCCTCTTCTCGAGAAGAGGCAAACTTCTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033414.2-736s1c1
Sequence:CCGGGATGGAGACGATTGGGAAGATCTCGAGATCTTCCCAATCGTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163825    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033414.2-1559s1c1
Sequence:CCGGCTGCTGGGATTGAGCAATCATCTCGAGATGATTGCTCAATCCCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033414
VALIDATED
ZNF622 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 622
Human
20 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033414.2-1513s21c1
Sequence:CCGGGCCACCAAGCAGATGCACTTTCTCGAGAAAGTGCATCTGCTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033414.2-666s21c1
Sequence:CCGGGTTTGAACAGCAGGCGAAGAACTCGAGTTCTTCGCCTGCTGTTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033414.2-415s21c1
Sequence:CCGGGTGCAGGCAGTGAATCGGAAACTCGAGTTTCCGATTCACTGCCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033414.2-920s21c1
Sequence:CCAGATGTGGCTCACATGACCAAAGCTCGAGCTTTGGTCATGTGAGCCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033414.2-979s21c1
Sequence:CCGGGATATTAAGGGACTGATTAAACTCGAGTTTAATCAGTCCCTTAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033414.2-1014s21c1
Sequence:CCGGAGTTGGTGTTGGCAAGATTTGCTCGAGCAAATCTTGCCAACACCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033414.2-1170s21c1
Sequence:CCGGGAGTAGCTATCCAGATCACAACTCGAGTTGTGATCTGGATAGCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033414.2-1254s21c1
Sequence:CCGGTGAAACCATGGAATTGATTCTCTCGAGAGAATCAATTCCATGGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033414.2-1044s1c1
Sequence:CCGGCAACGAGAAAGGGAAGTCCTTCTCGAGAAGGACTTCCCTTTCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033414.2-1311s1c1
Sequence:CCGGGAGATACTACAAACAGCGATTCTCGAGAATCGCTGTTTGTAGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033414.2-769s1c1
Sequence:CCGGGAAGAATTGGAATGTGAGGATCTCGAGATCCTCACATTCCAATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033414.2-1456s1c1
Sequence:CCGGCAGTATGTCCAAAGGATGAAACTCGAGTTTCATCCTTTGGACATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033414.2-943s1c1
Sequence:CCGGCACAGTTTCTTTATTCCTGATCTCGAGATCAGGAATAAAGAAACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033414.2-1084s1c1
Sequence:CCGGCAGGCACATATGAATGACAAACTCGAGTTTGTCATTCATATGTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033414.2-1485s1c1
Sequence:CCGGGATGCTGAAGACAGGAATGAACTCGAGTTCATTCCTGTCTTCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033414.2-426s1c1
Sequence:CCGGGAATCGGAAAGTGGAGATGATCTCGAGATCATCTCCACTTTCCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033414.2-1447s1c1
Sequence:CCGGCGAGACATGCAGTATGTCCAACTCGAGTTGGACATACTGCATGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033414.2-335s1c1
Sequence:CCGGGCAGTAAGAAGTTTGCCTCTTCTCGAGAAGAGGCAAACTTCTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033414.2-736s1c1
Sequence:CCGGGATGGAGACGATTGGGAAGATCTCGAGATCTTCCCAATCGTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163825    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033414.2-1559s1c1
Sequence:CCGGCTGCTGGGATTGAGCAATCATCTCGAGATGATTGCTCAATCCCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033414
VALIDATED
ZNF622 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 622
Human
20 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033414.2-1513s21c1
Sequence:CCGGGCCACCAAGCAGATGCACTTTCTCGAGAAAGTGCATCTGCTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033414.2-666s21c1
Sequence:CCGGGTTTGAACAGCAGGCGAAGAACTCGAGTTCTTCGCCTGCTGTTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033414.2-415s21c1
Sequence:CCGGGTGCAGGCAGTGAATCGGAAACTCGAGTTTCCGATTCACTGCCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033414.2-920s21c1
Sequence:CCAGATGTGGCTCACATGACCAAAGCTCGAGCTTTGGTCATGTGAGCCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033414.2-979s21c1
Sequence:CCGGGATATTAAGGGACTGATTAAACTCGAGTTTAATCAGTCCCTTAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033414.2-1014s21c1
Sequence:CCGGAGTTGGTGTTGGCAAGATTTGCTCGAGCAAATCTTGCCAACACCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033414.2-1170s21c1
Sequence:CCGGGAGTAGCTATCCAGATCACAACTCGAGTTGTGATCTGGATAGCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033414.2-1254s21c1
Sequence:CCGGTGAAACCATGGAATTGATTCTCTCGAGAGAATCAATTCCATGGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033414.2-1044s1c1
Sequence:CCGGCAACGAGAAAGGGAAGTCCTTCTCGAGAAGGACTTCCCTTTCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033414.2-1311s1c1
Sequence:CCGGGAGATACTACAAACAGCGATTCTCGAGAATCGCTGTTTGTAGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033414.2-769s1c1
Sequence:CCGGGAAGAATTGGAATGTGAGGATCTCGAGATCCTCACATTCCAATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033414.2-1456s1c1
Sequence:CCGGCAGTATGTCCAAAGGATGAAACTCGAGTTTCATCCTTTGGACATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033414.2-943s1c1
Sequence:CCGGCACAGTTTCTTTATTCCTGATCTCGAGATCAGGAATAAAGAAACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033414.2-1084s1c1
Sequence:CCGGCAGGCACATATGAATGACAAACTCGAGTTTGTCATTCATATGTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033414.2-1485s1c1
Sequence:CCGGGATGCTGAAGACAGGAATGAACTCGAGTTCATTCCTGTCTTCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033414.2-426s1c1
Sequence:CCGGGAATCGGAAAGTGGAGATGATCTCGAGATCATCTCCACTTTCCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033414.2-1447s1c1
Sequence:CCGGCGAGACATGCAGTATGTCCAACTCGAGTTGGACATACTGCATGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033414.2-335s1c1
Sequence:CCGGGCAGTAAGAAGTTTGCCTCTTCTCGAGAAGAGGCAAACTTCTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033414.2-736s1c1
Sequence:CCGGGATGGAGACGATTGGGAAGATCTCGAGATCTTCCCAATCGTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163825    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033414.2-1559s1c1
Sequence:CCGGCTGCTGGGATTGAGCAATCATCTCGAGATGATTGCTCAATCCCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks