EMAIL THIS PAGE TO A FRIEND

ZNF623

zinc finger protein 623

UniProtKB ID: O75123
Gene ID:
Horse(100065712) zinc finger protein 623
domestic cat(101090744) zinc finger protein 623
dog(100684723) zinc finger protein 623
cow(540256) zinc finger protein 623
sheep(101112741) zinc finger protein 623
naked mole-rat(101718159) zinc finger protein 623
domestic guinea pig(100730800) zinc finger protein 623
29 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014789 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014789 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014789 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047061 MISSION® esiRNA esiRNA human ZNF623 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001082480 Rosetta Predictions human pricing
NM_014789 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316613 predicted 1041
2 SASI_Hs02_00316614 predicted 631
3 SASI_Hs02_00316615 predicted 1591
4 SASI_Hs02_00316616 predicted 581
5 SASI_Hs02_00316617 predicted 920
6 SASI_Hs02_00316618 predicted 709
7 SASI_Hs02_00316619 predicted 476
8 SASI_Hs02_00316620 predicted 1775
9 SASI_Hs02_00316621 predicted 990
10 SASI_Hs02_00316622 predicted 1644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014789 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052768 predicted 942
2 SASI_Hs02_00346290 predicted 535
3 SASI_Hs01_00052769 predicted 1493
4 SASI_Hs01_00052770 predicted 478
5 SASI_Hs01_00052771 predicted 820
6 SASI_Hs01_00052772 predicted 618
7 SASI_Hs02_00346291 predicted 381
8 SASI_Hs01_00052773 predicted 1678
9 SASI_Hs01_00052776 predicted 884
10 SASI_Hs01_00052777 predicted 1538
11 SASI_Hs01_00052774 predicted 1851
12 SASI_Hs01_00052775 predicted 1890
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014789
ZNF623 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 623
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014789.1-5201s1c1
Sequence:CCGGGCCTGTATAATCCCAGCACTTCTCGAGAAGTGCTGGGATTATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014789.1-611s1c1
Sequence:CCGGCGTTTAATTCGGACCTAGTTACTCGAGTAACTAGGTCCGAATTAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014789.1-1117s1c1
Sequence:CCGGCATCGCTCAGACCTTATTGAACTCGAGTTCAATAAGGTCTGAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014789.1-1679s1c1
Sequence:CCGGGTAGTCAGTATGGGAGAGATTCTCGAGAATCTCTCCCATACTGACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014789.1-1365s1c1
Sequence:CCGGCTTTCTGAGTTCATACCTTATCTCGAGATAAGGTATGAACTCAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014789.3-1577s21c1
Sequence:CCGGTAACTCAACTACAAACGTTAACTCGAGTTAACGTTTGTAGTTGAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014789.3-674s21c1
Sequence:CCGGTGAGCATCAGCGCGTTCATTCCTCGAGGAATGAACGCGCTGATGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014789.3-1425s21c1
Sequence:CCGGCTGCTTCTGCACCAGATTATTCTCGAGAATAATCTGGTGCAGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014789.3-915s21c1
Sequence:CCGGTCGAGCCTCATTCGCCATTATCTCGAGATAATGGCGAATGAGGCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014789.3-3370s21c1
Sequence:CCGGTCGAAAGCAGGCGAGGTAAATCTCGAGATTTACCTCGCCTGCTTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014789
ZNF623 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 623
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014789.1-5201s1c1
Sequence:CCGGGCCTGTATAATCCCAGCACTTCTCGAGAAGTGCTGGGATTATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014789.1-611s1c1
Sequence:CCGGCGTTTAATTCGGACCTAGTTACTCGAGTAACTAGGTCCGAATTAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014789.1-1117s1c1
Sequence:CCGGCATCGCTCAGACCTTATTGAACTCGAGTTCAATAAGGTCTGAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014789.1-1679s1c1
Sequence:CCGGGTAGTCAGTATGGGAGAGATTCTCGAGAATCTCTCCCATACTGACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014789.1-1365s1c1
Sequence:CCGGCTTTCTGAGTTCATACCTTATCTCGAGATAAGGTATGAACTCAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014789.3-1577s21c1
Sequence:CCGGTAACTCAACTACAAACGTTAACTCGAGTTAACGTTTGTAGTTGAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014789.3-674s21c1
Sequence:CCGGTGAGCATCAGCGCGTTCATTCCTCGAGGAATGAACGCGCTGATGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014789.3-1425s21c1
Sequence:CCGGCTGCTTCTGCACCAGATTATTCTCGAGAATAATCTGGTGCAGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014789.3-915s21c1
Sequence:CCGGTCGAGCCTCATTCGCCATTATCTCGAGATAATGGCGAATGAGGCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014789.3-3370s21c1
Sequence:CCGGTCGAAAGCAGGCGAGGTAAATCTCGAGATTTACCTCGCCTGCTTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014789
ZNF623 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 623
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014789.1-5201s1c1
Sequence:CCGGGCCTGTATAATCCCAGCACTTCTCGAGAAGTGCTGGGATTATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014789.1-611s1c1
Sequence:CCGGCGTTTAATTCGGACCTAGTTACTCGAGTAACTAGGTCCGAATTAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014789.1-1117s1c1
Sequence:CCGGCATCGCTCAGACCTTATTGAACTCGAGTTCAATAAGGTCTGAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014789.1-1679s1c1
Sequence:CCGGGTAGTCAGTATGGGAGAGATTCTCGAGAATCTCTCCCATACTGACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014789.1-1365s1c1
Sequence:CCGGCTTTCTGAGTTCATACCTTATCTCGAGATAAGGTATGAACTCAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014789.3-1577s21c1
Sequence:CCGGTAACTCAACTACAAACGTTAACTCGAGTTAACGTTTGTAGTTGAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014789.3-674s21c1
Sequence:CCGGTGAGCATCAGCGCGTTCATTCCTCGAGGAATGAACGCGCTGATGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014789.3-1425s21c1
Sequence:CCGGCTGCTTCTGCACCAGATTATTCTCGAGAATAATCTGGTGCAGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014789.3-915s21c1
Sequence:CCGGTCGAGCCTCATTCGCCATTATCTCGAGATAATGGCGAATGAGGCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014789.3-3370s21c1
Sequence:CCGGTCGAAAGCAGGCGAGGTAAATCTCGAGATTTACCTCGCCTGCTTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks