EMAIL THIS PAGE TO A FRIEND

ZNF624

zinc finger protein 624

UniProtKB ID: Q9P2J8, Q3SY62, Q3SY63, Q6ZN27
Gene ID:
domestic guinea pig(100722701) zinc finger protein 624
naked mole-rat(101714517) zinc finger protein 624
cow(508931) zinc finger protein 624
sheep(101117000) zinc finger protein 624
domestic cat(101092967) zinc finger protein 624
Horse(100073139) zinc finger protein 624
dog(489520) zinc finger protein 624
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_047617 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_047617 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_047617 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020787 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020787 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070582 predicted 2016
2 SASI_Hs01_00070584 predicted 2372
3 SASI_Hs01_00070585 predicted 939
4 SASI_Hs02_00353943 predicted 1871
5 SASI_Hs01_00070587 predicted 936
6 SASI_Hs02_00353944 predicted 2286
7 SASI_Hs01_00070588 predicted 2030
8 SASI_Hs01_00070589 predicted 1536
9 SASI_Hs01_00070591 predicted 671
10 SASI_Hs02_00353945 predicted 660
11 SASI_Hs01_00070583 predicted 1872
12 SASI_Hs01_00070586 predicted 691
13 SASI_Hs01_00070590 predicted 1295
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_047617
ZNF624 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 624
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047617.7-2445s1c1
Sequence:CCGGTCAGGAGTAGTTCGAGCCTTACTCGAGTAAGGCTCGAACTACTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_047617.7-3476s1c1
Sequence:CCGGCCAACTGCAAACAAAGTGAATCTCGAGATTCACTTTGTTTGCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047617.7-2036s1c1
Sequence:CCGGTCAGGCTTTAATACACATCAACTCGAGTTGATGTGTATTAAAGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047617.7-933s1c1
Sequence:CCGGTCATTGCTTCTTCATCACTTACTCGAGTAAGTGATGAAGAAGCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047617.7-1636s1c1
Sequence:CCGGGCGTATTCATACTGAAGAGAACTCGAGTTCTCTTCAGTATGAATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_047617
ZNF624 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 624
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047617.7-2445s1c1
Sequence:CCGGTCAGGAGTAGTTCGAGCCTTACTCGAGTAAGGCTCGAACTACTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_047617.7-3476s1c1
Sequence:CCGGCCAACTGCAAACAAAGTGAATCTCGAGATTCACTTTGTTTGCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047617.7-2036s1c1
Sequence:CCGGTCAGGCTTTAATACACATCAACTCGAGTTGATGTGTATTAAAGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047617.7-933s1c1
Sequence:CCGGTCATTGCTTCTTCATCACTTACTCGAGTAAGTGATGAAGAAGCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047617.7-1636s1c1
Sequence:CCGGGCGTATTCATACTGAAGAGAACTCGAGTTCTCTTCAGTATGAATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_047617
ZNF624 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 624
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047617.7-2445s1c1
Sequence:CCGGTCAGGAGTAGTTCGAGCCTTACTCGAGTAAGGCTCGAACTACTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_047617.7-3476s1c1
Sequence:CCGGCCAACTGCAAACAAAGTGAATCTCGAGATTCACTTTGTTTGCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047617.7-2036s1c1
Sequence:CCGGTCAGGCTTTAATACACATCAACTCGAGTTGATGTGTATTAAAGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047617.7-933s1c1
Sequence:CCGGTCATTGCTTCTTCATCACTTACTCGAGTAAGTGATGAAGAAGCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047617.7-1636s1c1
Sequence:CCGGGCGTATTCATACTGAAGAGAACTCGAGTTCTCTTCAGTATGAATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks