EMAIL THIS PAGE TO A FRIEND

ZNF625

zinc finger protein 625

Species: Human ZNF625(90589)
UniProtKB ID: Q96I27, A4FU45, I3L0E9
Gene ID:
9 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145233 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145233 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145233 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145233 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145233 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229325 predicted 681
2 SASI_Hs01_00229326 predicted 372
3 SASI_Hs01_00229327 predicted 1008
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145233
ZNF625 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 625
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145233.2-1008s1c1
Sequence:CCGGTCTTTCAATTCCGTTCGATATCTCGAGATATCGAACGGAATTGAAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145233.2-877s1c1
Sequence:CCGGCTGGAGAGAAGCCTTATGAATCTCGAGATTCATAAGGCTTCTCTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145233.2-761s1c1
Sequence:CCGGCAGTTTGTATCTTATCCACAACTCGAGTTGTGGATAAGATACAAACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145233.2-469s1c1
Sequence:CCGGGCGTGGGTCATGCATCCCTTACTCGAGTAAGGGATGCATGACCCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145233.2-1099s1c1
Sequence:CCGGCGCACCTTCGAACACATGGAACTCGAGTTCCATGTGTTCGAAGGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145233.2-930s21c1
Sequence:CCGGACATGCCTCCATGCACATAAACTCGAGTTTATGTGCATGGAGGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145233.2-1253s21c1
Sequence:CCGGAGGCGAGAAGATTGCTTAATTCTCGAGAATTAAGCAATCTTCTCGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145233.2-1503s21c1
Sequence:CCGGCACCTCCAGTAAGACCTTAAGCTCGAGCTTAAGGTCTTACTGGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145233
ZNF625 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 625
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145233.2-1008s1c1
Sequence:CCGGTCTTTCAATTCCGTTCGATATCTCGAGATATCGAACGGAATTGAAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145233.2-877s1c1
Sequence:CCGGCTGGAGAGAAGCCTTATGAATCTCGAGATTCATAAGGCTTCTCTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145233.2-761s1c1
Sequence:CCGGCAGTTTGTATCTTATCCACAACTCGAGTTGTGGATAAGATACAAACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145233.2-469s1c1
Sequence:CCGGGCGTGGGTCATGCATCCCTTACTCGAGTAAGGGATGCATGACCCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145233.2-1099s1c1
Sequence:CCGGCGCACCTTCGAACACATGGAACTCGAGTTCCATGTGTTCGAAGGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145233.2-930s21c1
Sequence:CCGGACATGCCTCCATGCACATAAACTCGAGTTTATGTGCATGGAGGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145233.2-1253s21c1
Sequence:CCGGAGGCGAGAAGATTGCTTAATTCTCGAGAATTAAGCAATCTTCTCGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145233.2-1503s21c1
Sequence:CCGGCACCTCCAGTAAGACCTTAAGCTCGAGCTTAAGGTCTTACTGGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145233
ZNF625 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 625
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145233.2-1008s1c1
Sequence:CCGGTCTTTCAATTCCGTTCGATATCTCGAGATATCGAACGGAATTGAAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145233.2-877s1c1
Sequence:CCGGCTGGAGAGAAGCCTTATGAATCTCGAGATTCATAAGGCTTCTCTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145233.2-761s1c1
Sequence:CCGGCAGTTTGTATCTTATCCACAACTCGAGTTGTGGATAAGATACAAACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145233.2-469s1c1
Sequence:CCGGGCGTGGGTCATGCATCCCTTACTCGAGTAAGGGATGCATGACCCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145233.2-1099s1c1
Sequence:CCGGCGCACCTTCGAACACATGGAACTCGAGTTCCATGTGTTCGAAGGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145233.2-930s21c1
Sequence:CCGGACATGCCTCCATGCACATAAACTCGAGTTTATGTGCATGGAGGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145233.2-1253s21c1
Sequence:CCGGAGGCGAGAAGATTGCTTAATTCTCGAGAATTAAGCAATCTTCTCGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145233.2-1503s21c1
Sequence:CCGGCACCTCCAGTAAGACCTTAAGCTCGAGCTTAAGGTCTTACTGGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks