EMAIL THIS PAGE TO A FRIEND

ZNF626

zinc finger protein 626

Species: Human ZNF626(199777)
UniProtKB ID: Q68DY1, Q8N8T4, Q96QM1
Gene ID:
29 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145297 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145297 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145297 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001076675 Rosetta Predictions human pricing
NM_145297 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001076675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311946 predicted 332
2 SASI_Hs02_00311947 predicted 489
3 SASI_Hs02_00311948 predicted 778
4 SASI_Hs02_00311949 predicted 1781
5 SASI_Hs02_00311950 predicted 1270
6 SASI_Hs02_00311951 predicted 1289
7 SASI_Hs02_00311952 predicted 767
8 SASI_Hs02_00311953 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145297 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098192 predicted 331
2 SASI_Hs01_00098193 predicted 331
3 SASI_Hs01_00098194 predicted 460
4 SASI_Hs01_00098195 predicted 520
5 SASI_Hs02_00365188 predicted 510
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145297
ZNF626 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 626
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145297.3-333s21c1
Sequence:CCGGACCTTTGACCATGAAGAGAAACTCGAGTTTCTCTTCATGGTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145297.3-358s21c1
Sequence:CCGGATGATAGCCAAACCCTCAGTGCTCGAGCACTGAGGGTTTGGCTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145297.3-425s21c1
Sequence:CCGGTATAAGAGACTGCACAGTGTGCTCGAGCACACTGTGCAGTCTCTTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145297.3-410s21c1
Sequence:GTACCGGGTCCTCTTCATGACATATAAGCTCGAGCTTATATGTCATGAAGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145297.3-903s21c1
Sequence:CCGGGATTTACCTCCTTGGTTAATACTCGAGTATTAACCAAGGAGGTAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145297.1-352s1c1
Sequence:CCGGTCAGTGAGCTTCCTTCAAGTTCTCGAGAACTTGAAGGAAGCTCACTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145297.1-255s1c1
Sequence:CCGGCCTTGGTATTACTGTTTCTAACTCGAGTTAGAAACAGTAATACCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145297.1-383s1c1
Sequence:CCGGGCCAAAGTCCTCTTCATGACACTCGAGTGTCATGAAGAGGACTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145297.1-313s1c1
Sequence:CCGGCCTTTGACCATGAAGAGAAATCTCGAGATTTCTCTTCATGGTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145297.1-338s1c1
Sequence:CCGGTGATAGCCAAACCCTCAGTGACTCGAGTCACTGAGGGTTTGGCTATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145297
ZNF626 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 626
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145297.3-333s21c1
Sequence:CCGGACCTTTGACCATGAAGAGAAACTCGAGTTTCTCTTCATGGTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145297.3-358s21c1
Sequence:CCGGATGATAGCCAAACCCTCAGTGCTCGAGCACTGAGGGTTTGGCTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145297.3-425s21c1
Sequence:CCGGTATAAGAGACTGCACAGTGTGCTCGAGCACACTGTGCAGTCTCTTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145297.3-410s21c1
Sequence:GTACCGGGTCCTCTTCATGACATATAAGCTCGAGCTTATATGTCATGAAGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145297.3-903s21c1
Sequence:CCGGGATTTACCTCCTTGGTTAATACTCGAGTATTAACCAAGGAGGTAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145297.1-352s1c1
Sequence:CCGGTCAGTGAGCTTCCTTCAAGTTCTCGAGAACTTGAAGGAAGCTCACTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145297.1-255s1c1
Sequence:CCGGCCTTGGTATTACTGTTTCTAACTCGAGTTAGAAACAGTAATACCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145297.1-383s1c1
Sequence:CCGGGCCAAAGTCCTCTTCATGACACTCGAGTGTCATGAAGAGGACTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145297.1-313s1c1
Sequence:CCGGCCTTTGACCATGAAGAGAAATCTCGAGATTTCTCTTCATGGTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145297.1-338s1c1
Sequence:CCGGTGATAGCCAAACCCTCAGTGACTCGAGTCACTGAGGGTTTGGCTATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145297
ZNF626 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 626
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145297.3-333s21c1
Sequence:CCGGACCTTTGACCATGAAGAGAAACTCGAGTTTCTCTTCATGGTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145297.3-358s21c1
Sequence:CCGGATGATAGCCAAACCCTCAGTGCTCGAGCACTGAGGGTTTGGCTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145297.3-425s21c1
Sequence:CCGGTATAAGAGACTGCACAGTGTGCTCGAGCACACTGTGCAGTCTCTTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145297.3-410s21c1
Sequence:GTACCGGGTCCTCTTCATGACATATAAGCTCGAGCTTATATGTCATGAAGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145297.3-903s21c1
Sequence:CCGGGATTTACCTCCTTGGTTAATACTCGAGTATTAACCAAGGAGGTAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145297.1-352s1c1
Sequence:CCGGTCAGTGAGCTTCCTTCAAGTTCTCGAGAACTTGAAGGAAGCTCACTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145297.1-255s1c1
Sequence:CCGGCCTTGGTATTACTGTTTCTAACTCGAGTTAGAAACAGTAATACCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145297.1-383s1c1
Sequence:CCGGGCCAAAGTCCTCTTCATGACACTCGAGTGTCATGAAGAGGACTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145297.1-313s1c1
Sequence:CCGGCCTTTGACCATGAAGAGAAATCTCGAGATTTCTCTTCATGGTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145297.1-338s1c1
Sequence:CCGGTGATAGCCAAACCCTCAGTGACTCGAGTCACTGAGGGTTTGGCTATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks