EMAIL THIS PAGE TO A FRIEND

ZNF627

zinc finger protein 627

UniProtKB ID: Q7L945, O14846, Q4KMP9, Q6NT81, Q9BRG4
Gene ID:
cow(505918) zinc finger protein 627
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145295 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145295 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145295 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145295 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145295 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137444 predicted 1399
2 SASI_Hs01_00137445 predicted 1322
3 SASI_Hs01_00137446 predicted 1061
4 SASI_Hs01_00137447 predicted 1446
5 SASI_Hs01_00137449 predicted 549
6 SASI_Hs02_00365183 predicted 891
7 SASI_Hs02_00365184 predicted 1561
8 SASI_Hs02_00365185 predicted 1525
9 SASI_Hs01_00137441 predicted 825
10 SASI_Hs01_00137442 predicted 733
11 SASI_Hs01_00137443 predicted 822
12 SASI_Hs01_00137448 predicted 818
13 SASI_Hs01_00137450 predicted 633
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145295
VALIDATED
ZNF627 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 627
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145295.2-723s1c1
Sequence:CCGGGCCTTTGATTATCCCAGTTTACTCGAGTAAACTGGGATAATCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145295.2-1404s1c1
Sequence:CCGGCGATCCACTTACTTTCGAGTACTCGAGTACTCGAAAGTAAGTGGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145295.2-263s1c1
Sequence:CCGGCCAGAACATTGAAGACCCATTCTCGAGAATGGGTCTTCAATGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145295.2-1476s1c1
Sequence:CCGGGCTTCAGTTGTCCCAGTTCTTCTCGAGAAGAACTGGGACAACTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145295.2-483s21c1
Sequence:CCGGCACACTGGACGTGAACCAAATCTCGAGATTTGGTTCACGTCCAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145295.2-1399s21c1
Sequence:CCGGTCAGTCGATCCACTTACTTTCCTCGAGGAAAGTAAGTGGATCGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145295.2-448s21c1
Sequence:GTACCGGTGGGTCCTTCATCACTTAATACTCGAGTATTAAGTGATGAAGGACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229741    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145295.2-2121s21c1
Sequence:CCGGGAATTGGCATACGGTCTAATTCTCGAGAATTAGACCGTATGCCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145295.2-546s21c1
Sequence:CCGGTGTGGACGAGCCTTGAGTTATCTCGAGATAACTCAAGGCTCGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145295
VALIDATED
ZNF627 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 627
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145295.2-723s1c1
Sequence:CCGGGCCTTTGATTATCCCAGTTTACTCGAGTAAACTGGGATAATCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145295.2-1404s1c1
Sequence:CCGGCGATCCACTTACTTTCGAGTACTCGAGTACTCGAAAGTAAGTGGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145295.2-263s1c1
Sequence:CCGGCCAGAACATTGAAGACCCATTCTCGAGAATGGGTCTTCAATGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145295.2-1476s1c1
Sequence:CCGGGCTTCAGTTGTCCCAGTTCTTCTCGAGAAGAACTGGGACAACTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145295.2-483s21c1
Sequence:CCGGCACACTGGACGTGAACCAAATCTCGAGATTTGGTTCACGTCCAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145295.2-1399s21c1
Sequence:CCGGTCAGTCGATCCACTTACTTTCCTCGAGGAAAGTAAGTGGATCGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145295.2-448s21c1
Sequence:GTACCGGTGGGTCCTTCATCACTTAATACTCGAGTATTAAGTGATGAAGGACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229741    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145295.2-2121s21c1
Sequence:CCGGGAATTGGCATACGGTCTAATTCTCGAGAATTAGACCGTATGCCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145295.2-546s21c1
Sequence:CCGGTGTGGACGAGCCTTGAGTTATCTCGAGATAACTCAAGGCTCGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145295
VALIDATED
ZNF627 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 627
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145295.2-723s1c1
Sequence:CCGGGCCTTTGATTATCCCAGTTTACTCGAGTAAACTGGGATAATCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145295.2-1404s1c1
Sequence:CCGGCGATCCACTTACTTTCGAGTACTCGAGTACTCGAAAGTAAGTGGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145295.2-263s1c1
Sequence:CCGGCCAGAACATTGAAGACCCATTCTCGAGAATGGGTCTTCAATGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145295.2-1476s1c1
Sequence:CCGGGCTTCAGTTGTCCCAGTTCTTCTCGAGAAGAACTGGGACAACTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145295.2-483s21c1
Sequence:CCGGCACACTGGACGTGAACCAAATCTCGAGATTTGGTTCACGTCCAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145295.2-1399s21c1
Sequence:CCGGTCAGTCGATCCACTTACTTTCCTCGAGGAAAGTAAGTGGATCGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145295.2-448s21c1
Sequence:GTACCGGTGGGTCCTTCATCACTTAATACTCGAGTATTAAGTGATGAAGGACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229741    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145295.2-2121s21c1
Sequence:CCGGGAATTGGCATACGGTCTAATTCTCGAGAATTAGACCGTATGCCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145295.2-546s21c1
Sequence:CCGGTGTGGACGAGCCTTGAGTTATCTCGAGATAACTCAAGGCTCGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks