EMAIL THIS PAGE TO A FRIEND

ZNF628

zinc finger protein 628

Synonyms: ZEC Zfp628
UniProtKB ID: Q5EBL2, Q86X34
Gene ID:
Human(89887) Summary: Zinc finger proteins (ZNFs), which bind nucleic acids, perform many key functions, the most important of which is regulating transcription. See ZNF91 (MIM 603971) for general information on ZNFs.[supplied by OMIM, Mar 2008]
cow(615021) zinc finger protein 628
sheep(101119751) zinc finger protein 628
domestic guinea pig(100720224) zinc finger protein 628
chicken(100857228) zinc finger protein 628
domestic cat(101090061) zinc finger protein 628
dog(484294) zinc finger protein 628
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033113 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033113 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033113 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU217971 MISSION® esiRNA esiRNA targeting human ZNF628 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033113 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026861 predicted 3208
2 SASI_Hs01_00026862 predicted 2677
3 SASI_Hs01_00026863 predicted 3459
4 SASI_Hs01_00026864 predicted 3393
5 SASI_Hs01_00026865 predicted 2432
6 SASI_Hs01_00026866 predicted 947
7 SASI_Hs01_00026867 predicted 3203
8 SASI_Hs02_00360831 predicted 3312
9 SASI_Hs01_00026868 predicted 3122
10 SASI_Hs01_00026869 predicted 3610
11 SASI_Hs01_00026870 predicted 938
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033113
ZNF628 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 628
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033113.2-2943s21c1
Sequence:CCGGAGAGCCTCATCGTTCTGCAGACTCGAGTCTGCAGAACGATGAGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033113.2-3681s21c1
Sequence:CCGGCCATCCAGATTGTCCAGACTCCTCGAGGAGTCTGGACAATCTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033113.2-3381s21c1
Sequence:CCGGATGGCGAACAGACTCGACTCTCTCGAGAGAGTCGAGTCTGTTCGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033113.2-2682s21c1
Sequence:CCGGAGACGTTCCTCCTGGTGCAAACTCGAGTTTGCACCAGGAGGAACGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033113.1-3031s1c1
Sequence:CCGGCCCAGAAGTAACCACGGTCCACTCGAGTGGACCGTGGTTACTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033113.1-3404s1c1
Sequence:CCGGGTACAGGAGGTAGAAACACTTCTCGAGAAGTGTTTCTACCTCCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033113.1-3462s1c1
Sequence:CCGGCCGGACAGAAACTCCTCATCACTCGAGTGATGAGGAGTTTCTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033113.1-950s1c1
Sequence:CCGGTCCCACTACCAGTACCACTTACTCGAGTAAGTGGTACTGGTAGTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033113.1-762s1c1
Sequence:CCGGCCAAGGCTTTCAAAGGCTCCTCTCGAGAGGAGCCTTTGAAAGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033113
ZNF628 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 628
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033113.2-2943s21c1
Sequence:CCGGAGAGCCTCATCGTTCTGCAGACTCGAGTCTGCAGAACGATGAGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033113.2-3681s21c1
Sequence:CCGGCCATCCAGATTGTCCAGACTCCTCGAGGAGTCTGGACAATCTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033113.2-3381s21c1
Sequence:CCGGATGGCGAACAGACTCGACTCTCTCGAGAGAGTCGAGTCTGTTCGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033113.2-2682s21c1
Sequence:CCGGAGACGTTCCTCCTGGTGCAAACTCGAGTTTGCACCAGGAGGAACGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033113.1-3031s1c1
Sequence:CCGGCCCAGAAGTAACCACGGTCCACTCGAGTGGACCGTGGTTACTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033113.1-3404s1c1
Sequence:CCGGGTACAGGAGGTAGAAACACTTCTCGAGAAGTGTTTCTACCTCCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033113.1-3462s1c1
Sequence:CCGGCCGGACAGAAACTCCTCATCACTCGAGTGATGAGGAGTTTCTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033113.1-950s1c1
Sequence:CCGGTCCCACTACCAGTACCACTTACTCGAGTAAGTGGTACTGGTAGTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033113.1-762s1c1
Sequence:CCGGCCAAGGCTTTCAAAGGCTCCTCTCGAGAGGAGCCTTTGAAAGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033113
ZNF628 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 628
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033113.2-2943s21c1
Sequence:CCGGAGAGCCTCATCGTTCTGCAGACTCGAGTCTGCAGAACGATGAGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033113.2-3681s21c1
Sequence:CCGGCCATCCAGATTGTCCAGACTCCTCGAGGAGTCTGGACAATCTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033113.2-3381s21c1
Sequence:CCGGATGGCGAACAGACTCGACTCTCTCGAGAGAGTCGAGTCTGTTCGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033113.2-2682s21c1
Sequence:CCGGAGACGTTCCTCCTGGTGCAAACTCGAGTTTGCACCAGGAGGAACGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033113.1-3031s1c1
Sequence:CCGGCCCAGAAGTAACCACGGTCCACTCGAGTGGACCGTGGTTACTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033113.1-3404s1c1
Sequence:CCGGGTACAGGAGGTAGAAACACTTCTCGAGAAGTGTTTCTACCTCCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033113.1-3462s1c1
Sequence:CCGGCCGGACAGAAACTCCTCATCACTCGAGTGATGAGGAGTTTCTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033113.1-950s1c1
Sequence:CCGGTCCCACTACCAGTACCACTTACTCGAGTAAGTGGTACTGGTAGTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033113.1-762s1c1
Sequence:CCGGCCAAGGCTTTCAAAGGCTCCTCTCGAGAGGAGCCTTTGAAAGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks