EMAIL THIS PAGE TO A FRIEND

ZNF629

zinc finger protein 629

Synonyms: ZNF ZNF65
UniProtKB ID: Q9UEG4, Q15938
Gene ID:
Horse(100065151) zinc finger protein 629
domestic cat(101091833) zinc finger protein 629
dog(489914) zinc finger protein 629
domestic guinea pig(100715080) zinc finger protein 629
naked mole-rat(101702799) zinc finger protein 629
cow(615311) zinc finger protein 629
sheep(101102863) zinc finger protein 629
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080417 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080417 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080417 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054011 MISSION® esiRNA esiRNA human ZNF629 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080417 Rosetta Predictions human pricing
XM_034819 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314646 predicted 1700
2 SASI_Hs02_00314647 predicted 551
3 SASI_Hs02_00314648 predicted 2503
4 SASI_Hs02_00314649 predicted 1321
5 SASI_Hs02_00314650 predicted 1575
6 SASI_Hs02_00314651 predicted 1098
7 SASI_Hs02_00314652 predicted 2743
8 SASI_Hs02_00314653 predicted 2209
9 SASI_Hs02_00314654 predicted 2211
10 SASI_Hs02_00314655 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_034819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298087 predicted 1656
2 SASI_Hs01_00298088 predicted 822
3 SASI_Hs01_00298089 predicted 515
4 SASI_Hs01_00298090 predicted 2468
5 SASI_Hs01_00298091 predicted 1288
6 SASI_Hs01_00298092 predicted 1533
7 SASI_Hs01_00298093 predicted 1069
8 SASI_Hs01_00298094 predicted 2702
9 SASI_Hs01_00298095 predicted 2169
10 SASI_Hs01_00298096 predicted 649
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080417
ZNF629 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 629
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000236643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080417.1-2275s21c1
Sequence:CCGGCTTTCTCTTTCCTGATTATAGCTCGAGCTATAATCAGGAAAGAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080417.1-1941s21c1
Sequence:CCGGTCAACGACGAGGGCATCTTCACTCGAGTGAAGATGCCCTCGTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080417.1-5317s21c1
Sequence:CCGGGGACTAGGGTGTAGCATATTTCTCGAGAAATATGCTACACCCTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080417.1-2333s21c1
Sequence:CCGGTTAAGTGGGAAGCCCTTTAAACTCGAGTTTAAAGGGCTTCCCACTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080417
ZNF629 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 629
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000236643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080417.1-2275s21c1
Sequence:CCGGCTTTCTCTTTCCTGATTATAGCTCGAGCTATAATCAGGAAAGAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080417.1-1941s21c1
Sequence:CCGGTCAACGACGAGGGCATCTTCACTCGAGTGAAGATGCCCTCGTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080417.1-5317s21c1
Sequence:CCGGGGACTAGGGTGTAGCATATTTCTCGAGAAATATGCTACACCCTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080417.1-2333s21c1
Sequence:CCGGTTAAGTGGGAAGCCCTTTAAACTCGAGTTTAAAGGGCTTCCCACTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080417
ZNF629 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 629
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000236643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080417.1-2275s21c1
Sequence:CCGGCTTTCTCTTTCCTGATTATAGCTCGAGCTATAATCAGGAAAGAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080417.1-1941s21c1
Sequence:CCGGTCAACGACGAGGGCATCTTCACTCGAGTGAAGATGCCCTCGTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080417.1-5317s21c1
Sequence:CCGGGGACTAGGGTGTAGCATATTTCTCGAGAAATATGCTACACCCTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080417.1-2333s21c1
Sequence:CCGGTTAAGTGGGAAGCCCTTTAAACTCGAGTTTAAAGGGCTTCCCACTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks