EMAIL THIS PAGE TO A FRIEND

ZNF630

zinc finger protein 630

Synonyms: dJ54B20.2
UniProtKB ID: Q2M218, F8WAG4, Q5H8Z5
Gene ID:
Human(57232) Summary: This gene encodes a zinc finger protein with an N-terminal Kruppel-associated box-containing (KRAB) domain and 13 Kruppel-type C2H2 zinc finger domains. Like other zinc finger proteins, this gene may function as a transcription factor. This gene resides on an area of chromosome X that has been implicated in nonsyndromic X-linked mental retardation. [provided by RefSeq, Jul 2010]
Horse(100061608) zinc finger protein 630
domestic cat(101082547) zinc finger protein 630
dog(491865) zinc finger protein 630
29 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037735 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037735 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037735 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037735 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156707 predicted 1620
2 SASI_Hs02_00308358 predicted 606
3 SASI_Hs01_00156708 predicted 1321
4 SASI_Hs02_00308359 predicted 408
5 SASI_Hs01_00156709 predicted 1826
6 SASI_Hs01_00156712 predicted 1125
7 SASI_Hs02_00308360 predicted 451
8 SASI_Hs01_00156713 predicted 1907
9 SASI_Hs02_00308361 predicted 312
10 SASI_Hs01_00156714 predicted 1213
11 SASI_Hs01_00156710 predicted 906
12 SASI_Hs01_00156711 predicted 1672
13 SASI_Hs01_00156715 predicted 2166
14 SASI_Hs01_00156716 predicted 1116
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037735
ZNF630 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 630
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037735.2-951s21c1
Sequence:CCGGGCCCTATGGAGATAGTCAATGCTCGAGCATTGACTATCTCCATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037735.2-2307s21c1
Sequence:CCGGTCAACTGTAGAATAGACTAATCTCGAGATTAGTCTATTCTACAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037735.2-2224s21c1
Sequence:CCGGTGATTGTGGGAAGGCCTATTCCTCGAGGAATAGGCCTTCCCACAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037735.2-2181s21c1
Sequence:CCGGTGGGCATCAGAATCCATATAGCTCGAGCTATATGGATTCTGATGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037735.2-810s21c1
Sequence:CCGGGTCTAATTCAGACTTACTAAACTCGAGTTTAGTAAGTCTGAATTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037735
ZNF630 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 630
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037735.2-951s21c1
Sequence:CCGGGCCCTATGGAGATAGTCAATGCTCGAGCATTGACTATCTCCATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037735.2-2307s21c1
Sequence:CCGGTCAACTGTAGAATAGACTAATCTCGAGATTAGTCTATTCTACAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037735.2-2224s21c1
Sequence:CCGGTGATTGTGGGAAGGCCTATTCCTCGAGGAATAGGCCTTCCCACAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037735.2-2181s21c1
Sequence:CCGGTGGGCATCAGAATCCATATAGCTCGAGCTATATGGATTCTGATGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037735.2-810s21c1
Sequence:CCGGGTCTAATTCAGACTTACTAAACTCGAGTTTAGTAAGTCTGAATTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037735
ZNF630 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 630
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037735.2-951s21c1
Sequence:CCGGGCCCTATGGAGATAGTCAATGCTCGAGCATTGACTATCTCCATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037735.2-2307s21c1
Sequence:CCGGTCAACTGTAGAATAGACTAATCTCGAGATTAGTCTATTCTACAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037735.2-2224s21c1
Sequence:CCGGTGATTGTGGGAAGGCCTATTCCTCGAGGAATAGGCCTTCCCACAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037735.2-2181s21c1
Sequence:CCGGTGGGCATCAGAATCCATATAGCTCGAGCTATATGGATTCTGATGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037735.2-810s21c1
Sequence:CCGGGTCTAATTCAGACTTACTAAACTCGAGTTTAGTAAGTCTGAATTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks