EMAIL THIS PAGE TO A FRIEND

ZNF638

zinc finger protein 638

Synonyms: NP220 ZFML Zfp638
Gene ID:
Human(27332) Summary: The protein encoded by this gene is a nucleoplasmic protein. It binds cytidine-rich sequences in double-stranded DNA. This protein has three types of domains: MH1, MH2 (repeated three times) and MH3. It is associated with packaging, transferring, or processing transcripts. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
chicken(395593) zinc finger protein 638
domestic cat(101096883) zinc finger protein 638
Horse(100050145) zinc finger protein 638
dog(475799) zinc finger protein 638
cow(517669) zinc finger protein 638
sheep(101108732) zinc finger protein 638
naked mole-rat(101718907) zinc finger protein 638
domestic guinea pig(100716358) zinc finger protein 638
104 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014497 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014497 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014497 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065491 MISSION® esiRNA esiRNA human ZNF638 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014972 Rosetta Predictions human pricing
NM_014497 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247395 predicted 4932
2 SASI_Hs01_00247396 predicted 3317
3 SASI_Hs01_00247397 predicted 314
4 SASI_Hs02_00306594 predicted 2210
5 SASI_Hs02_00306595 predicted 2780
6 SASI_Hs01_00247400 predicted 1363
7 SASI_Hs01_00247401 predicted 618
8 SASI_Hs01_00247402 predicted 2035
9 SASI_Hs02_00306596 predicted 2316
10 SASI_Hs01_00247403 predicted 1875
11 SASI_Hs01_00247394 predicted 509
12 SASI_Hs01_00247398 predicted 6020
13 SASI_Hs01_00247399 predicted 1287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014497 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218933 predicted 4936
2 SASI_Hs01_00218934 predicted 3326
3 SASI_Hs01_00218935 predicted 324
4 SASI_Hs02_00345748 predicted 2219
5 SASI_Hs02_00345749 predicted 2786
6 SASI_Hs01_00218938 predicted 1371
7 SASI_Hs01_00218939 predicted 624
8 SASI_Hs01_00218940 predicted 2040
9 SASI_Hs02_00345750 predicted 2323
10 SASI_Hs01_00218941 predicted 1879
11 SASI_Hs01_00218932 predicted 516
12 SASI_Hs01_00218936 predicted 6025
13 SASI_Hs01_00218937 predicted 1294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014497
VALIDATED
ZNF638 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 638
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014497.3-1935s21c1
Sequence:CCGGCCCGTTCACCATATCGAATTACTCGAGTAATTCGATATGGTGAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014497.3-6341s21c1
Sequence:CCGGTCGTTTCAGAAGCAAATATTCCTCGAGGAATATTTGCTTCTGAAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014497.3-1246s21c1
Sequence:CCGGATCCGTCAACCAATCCATTAACTCGAGTTAATGGATTGGTTGACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014497.3-2191s21c1
Sequence:CCGGCGCTACAAAGAGTGATTCAAACTCGAGTTTGAATCACTCTTTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014497.3-795s21c1
Sequence:CCGGGCTATCCTGATGAACAACTAACTCGAGTTAGTTGTTCATCAGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_014497.2-790s1c1
Sequence:CCGGGCTATCCTGATGAACAACTAACTCGAGTTAGTTGTTCATCAGGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014497.2-733s1c1
Sequence:CCGGCCTCAAGTATCTTAGCAAGTTCTCGAGAACTTGCTAAGATACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014497.2-2186s1c1
Sequence:CCGGCGCTACAAAGAGTGATTCAAACTCGAGTTTGAATCACTCTTTGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014497.2-6060s1c1
Sequence:CCGGCCTGAGGAATTAGACTTTCTTCTCGAGAAGAAAGTCTAATTCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014497.2-3480s1c1
Sequence:CCGGGCTCAGTCAATGTATAGCTTTCTCGAGAAAGCTATACATTGACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014497
VALIDATED
ZNF638 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 638
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014497.3-1935s21c1
Sequence:CCGGCCCGTTCACCATATCGAATTACTCGAGTAATTCGATATGGTGAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014497.3-6341s21c1
Sequence:CCGGTCGTTTCAGAAGCAAATATTCCTCGAGGAATATTTGCTTCTGAAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014497.3-1246s21c1
Sequence:CCGGATCCGTCAACCAATCCATTAACTCGAGTTAATGGATTGGTTGACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014497.3-2191s21c1
Sequence:CCGGCGCTACAAAGAGTGATTCAAACTCGAGTTTGAATCACTCTTTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014497.3-795s21c1
Sequence:CCGGGCTATCCTGATGAACAACTAACTCGAGTTAGTTGTTCATCAGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_014497.2-790s1c1
Sequence:CCGGGCTATCCTGATGAACAACTAACTCGAGTTAGTTGTTCATCAGGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014497.2-733s1c1
Sequence:CCGGCCTCAAGTATCTTAGCAAGTTCTCGAGAACTTGCTAAGATACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014497.2-2186s1c1
Sequence:CCGGCGCTACAAAGAGTGATTCAAACTCGAGTTTGAATCACTCTTTGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014497.2-6060s1c1
Sequence:CCGGCCTGAGGAATTAGACTTTCTTCTCGAGAAGAAAGTCTAATTCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014497.2-3480s1c1
Sequence:CCGGGCTCAGTCAATGTATAGCTTTCTCGAGAAAGCTATACATTGACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014497
VALIDATED
ZNF638 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 638
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014497.3-1935s21c1
Sequence:CCGGCCCGTTCACCATATCGAATTACTCGAGTAATTCGATATGGTGAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014497.3-6341s21c1
Sequence:CCGGTCGTTTCAGAAGCAAATATTCCTCGAGGAATATTTGCTTCTGAAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014497.3-1246s21c1
Sequence:CCGGATCCGTCAACCAATCCATTAACTCGAGTTAATGGATTGGTTGACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014497.3-2191s21c1
Sequence:CCGGCGCTACAAAGAGTGATTCAAACTCGAGTTTGAATCACTCTTTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014497.3-795s21c1
Sequence:CCGGGCTATCCTGATGAACAACTAACTCGAGTTAGTTGTTCATCAGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_014497.2-790s1c1
Sequence:CCGGGCTATCCTGATGAACAACTAACTCGAGTTAGTTGTTCATCAGGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014497.2-733s1c1
Sequence:CCGGCCTCAAGTATCTTAGCAAGTTCTCGAGAACTTGCTAAGATACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014497.2-2186s1c1
Sequence:CCGGCGCTACAAAGAGTGATTCAAACTCGAGTTTGAATCACTCTTTGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014497.2-6060s1c1
Sequence:CCGGCCTGAGGAATTAGACTTTCTTCTCGAGAAGAAAGTCTAATTCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014497.2-3480s1c1
Sequence:CCGGGCTCAGTCAATGTATAGCTTTCTCGAGAAAGCTATACATTGACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks