EMAIL THIS PAGE TO A FRIEND

ZNF639

zinc finger protein 639

Synonyms: 6230400O18Rik ANC-2H01 ANC_2H01 ZASC1
UniProtKB ID: Q9UID6, A9X3Z9, D3DNR3
Gene ID:
chicken(425280) zinc finger protein 639
domestic cat(101088561) zinc finger protein 639
Horse(100058187) zinc finger protein 639
dog(478636) zinc finger protein 639
domestic guinea pig(100724560) zinc finger protein 639
naked mole-rat(101713970) zinc finger protein 639
Domestic Rabbit(100338075) zinc finger protein 639
cow(523536) zinc finger protein 639
sheep(101109501) zinc finger protein 639
27 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016331 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016331 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016331 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012521 MISSION® esiRNA esiRNA targeting human ZNF639 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016331 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016331 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105982 predicted 1299
2 SASI_Hs02_00349278 predicted 1458
3 SASI_Hs01_00105985 predicted 1475
4 SASI_Hs01_00105986 predicted 1690
5 SASI_Hs02_00349279 predicted 1025
6 SASI_Hs02_00349280 predicted 1413
7 SASI_Hs01_00105987 predicted 1009
8 SASI_Hs01_00105988 predicted 1443
9 SASI_Hs02_00349281 predicted 1398
10 SASI_Hs01_00105989 predicted 1383
11 SASI_Hs01_00105983 predicted 1463
12 SASI_Hs01_00105984 predicted 1000
13 SASI_Hs01_00105990 predicted 1281
14 SASI_Hs01_00105991 predicted 1715
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016331
VALIDATED
ZNF639 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 639
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016331.1-794s1c1
Sequence:CCGGCCTGAATCAGTCAACCAGCAACTCGAGTTGCTGGTTGACTGATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016331.1-1589s1c1
Sequence:CCGGCGGAGTAGACTTCACACAAATCTCGAGATTTGTGTGAAGTCTACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016331.1-1171s1c1
Sequence:CCGGCTCTACCAATATGCTTCTGATCTCGAGATCAGAAGCATATTGGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016331.1-2436s1c1
Sequence:CCGGGCCACTATCTATTGTTGAATACTCGAGTATTCAACAATAGATAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016331.1-1348s1c1
Sequence:CCGGCAGTGAACTCTACCTACATTTCTCGAGAAATGTAGGTAGAGTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016331.1-1123s1c1
Sequence:CCGGGCATAAACGTACTGATTCAAACTCGAGTTTGAATCAGTACGTTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016331.1-1118s1c1
Sequence:CCGGCTGAAGCATAAACGTACTGATCTCGAGATCAGTACGTTTATGCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016331.1-2099s1c1
Sequence:CCGGCGTGATAGTTTGTAGTTTCAACTCGAGTTGAAACTACAAACTATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016331.1-1347s1c1
Sequence:CCGGGCAGTGAACTCTACCTACATTCTCGAGAATGTAGGTAGAGTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016331.1-879s21c1
Sequence:CCGGATGCGATTTCTGAGGATTATGCTCGAGCATAATCCTCAGAAATCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016331.1-1041s21c1
Sequence:GTACCGGATAGCAGTGGCCTCTATAAATCTCGAGATTTATAGAGGCCACTGCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016331.1-1349s21c1
Sequence:GTACCGGAGTGAACTCTACCTACATTTCCTCGAGGAAATGTAGGTAGAGTTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016331.1-1163s21c1
Sequence:GTACCGGGAAAGTTTCTCTACCAATATGCTCGAGCATATTGGTAGAGAAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016331.1-2359s21c1
Sequence:CCGGACACTAGGAAGCCACTATTACCTCGAGGTAATAGTGGCTTCCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016331
VALIDATED
ZNF639 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 639
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016331.1-794s1c1
Sequence:CCGGCCTGAATCAGTCAACCAGCAACTCGAGTTGCTGGTTGACTGATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016331.1-1589s1c1
Sequence:CCGGCGGAGTAGACTTCACACAAATCTCGAGATTTGTGTGAAGTCTACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016331.1-1171s1c1
Sequence:CCGGCTCTACCAATATGCTTCTGATCTCGAGATCAGAAGCATATTGGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016331.1-2436s1c1
Sequence:CCGGGCCACTATCTATTGTTGAATACTCGAGTATTCAACAATAGATAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016331.1-1348s1c1
Sequence:CCGGCAGTGAACTCTACCTACATTTCTCGAGAAATGTAGGTAGAGTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016331.1-1123s1c1
Sequence:CCGGGCATAAACGTACTGATTCAAACTCGAGTTTGAATCAGTACGTTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016331.1-1118s1c1
Sequence:CCGGCTGAAGCATAAACGTACTGATCTCGAGATCAGTACGTTTATGCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016331.1-2099s1c1
Sequence:CCGGCGTGATAGTTTGTAGTTTCAACTCGAGTTGAAACTACAAACTATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016331.1-1347s1c1
Sequence:CCGGGCAGTGAACTCTACCTACATTCTCGAGAATGTAGGTAGAGTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016331.1-879s21c1
Sequence:CCGGATGCGATTTCTGAGGATTATGCTCGAGCATAATCCTCAGAAATCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016331.1-1041s21c1
Sequence:GTACCGGATAGCAGTGGCCTCTATAAATCTCGAGATTTATAGAGGCCACTGCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016331.1-1349s21c1
Sequence:GTACCGGAGTGAACTCTACCTACATTTCCTCGAGGAAATGTAGGTAGAGTTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016331.1-1163s21c1
Sequence:GTACCGGGAAAGTTTCTCTACCAATATGCTCGAGCATATTGGTAGAGAAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016331.1-2359s21c1
Sequence:CCGGACACTAGGAAGCCACTATTACCTCGAGGTAATAGTGGCTTCCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016331
VALIDATED
ZNF639 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 639
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016331.1-794s1c1
Sequence:CCGGCCTGAATCAGTCAACCAGCAACTCGAGTTGCTGGTTGACTGATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016331.1-1589s1c1
Sequence:CCGGCGGAGTAGACTTCACACAAATCTCGAGATTTGTGTGAAGTCTACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016331.1-1171s1c1
Sequence:CCGGCTCTACCAATATGCTTCTGATCTCGAGATCAGAAGCATATTGGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016331.1-2436s1c1
Sequence:CCGGGCCACTATCTATTGTTGAATACTCGAGTATTCAACAATAGATAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016331.1-1348s1c1
Sequence:CCGGCAGTGAACTCTACCTACATTTCTCGAGAAATGTAGGTAGAGTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016331.1-1123s1c1
Sequence:CCGGGCATAAACGTACTGATTCAAACTCGAGTTTGAATCAGTACGTTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016331.1-1118s1c1
Sequence:CCGGCTGAAGCATAAACGTACTGATCTCGAGATCAGTACGTTTATGCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016331.1-2099s1c1
Sequence:CCGGCGTGATAGTTTGTAGTTTCAACTCGAGTTGAAACTACAAACTATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016331.1-1347s1c1
Sequence:CCGGGCAGTGAACTCTACCTACATTCTCGAGAATGTAGGTAGAGTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016331.1-879s21c1
Sequence:CCGGATGCGATTTCTGAGGATTATGCTCGAGCATAATCCTCAGAAATCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016331.1-1041s21c1
Sequence:GTACCGGATAGCAGTGGCCTCTATAAATCTCGAGATTTATAGAGGCCACTGCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016331.1-1349s21c1
Sequence:GTACCGGAGTGAACTCTACCTACATTTCCTCGAGGAAATGTAGGTAGAGTTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016331.1-1163s21c1
Sequence:GTACCGGGAAAGTTTCTCTACCAATATGCTCGAGCATATTGGTAGAGAAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016331.1-2359s21c1
Sequence:CCGGACACTAGGAAGCCACTATTACCTCGAGGTAATAGTGGCTTCCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks