EMAIL THIS PAGE TO A FRIEND

ZNF644

zinc finger protein 644

Synonyms: BM-005 MYP21 NatF ZEP-2
Gene ID:
Human(84146) Summary: The protein encoded by this gene is a zinc finger transcription factor that may play a role in eye development. Defects in this gene have been associated with high myopia. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
chicken(424510) zinc finger protein 644
dog(479957) zinc finger protein 644
domestic cat(101084639) zinc finger protein 644
Horse(100051777) zinc finger protein 644
cow(539923) zinc finger protein 644
sheep(101122642) zinc finger protein 644
naked mole-rat(101722027) zinc finger protein 644
domestic guinea pig(100717425) zinc finger protein 644
133 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2103097 Anti-ZNF644 antibody produced in rabbit affinity isolated antibody canine, guinea pig, horse, rabbit, mouse, human, rat, bovine
western blot pricing
HPA057795 Anti-ZNF644 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016620 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016620 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016620 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016620 Rosetta Predictions human pricing
NM_032186 Rosetta Predictions human pricing
NM_201269 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143747 predicted 847
2 SASI_Hs01_00143748 predicted 856
3 SASI_Hs01_00143749 predicted 775
4 SASI_Hs01_00143750 predicted 950
5 SASI_Hs01_00143751 predicted 984
6 SASI_Hs01_00143752 predicted 549
7 SASI_Hs01_00143753 predicted 506
8 SASI_Hs01_00143754 predicted 894
9 SASI_Hs01_00143755 predicted 426
10 SASI_Hs02_00349773 predicted 1038
11 SASI_Hs01_00143756 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032186 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247414 predicted 770
2 SASI_Hs01_00247415 predicted 778
3 SASI_Hs01_00247416 predicted 699
4 SASI_Hs01_00247417 predicted 875
5 SASI_Hs01_00247418 predicted 910
6 SASI_Hs01_00247419 predicted 472
7 SASI_Hs01_00247420 predicted 425
8 SASI_Hs01_00247421 predicted 816
9 SASI_Hs01_00247422 predicted 349
10 SASI_Hs02_00359466 predicted 968
11 SASI_Hs01_00247423 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081829 predicted 4413
2 SASI_Hs01_00081830 predicted 849
3 SASI_Hs01_00081831 predicted 2131
4 SASI_Hs02_00372912 predicted 2557
5 SASI_Hs02_00372913 predicted 1254
6 SASI_Hs01_00081833 predicted 2500
7 SASI_Hs01_00081834 predicted 863
8 SASI_Hs01_00081835 predicted 1885
9 SASI_Hs02_00372914 predicted 3517
10 SASI_Hs01_00081837 predicted 3418
11 SASI_Hs01_00081832 predicted 3648
12 SASI_Hs01_00081836 predicted 2764
13 SASI_Hs01_00081838 predicted 1859
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016620
VALIDATED
ZNF644 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 644
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121698    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_016620.2-581s1c1
Sequence:CCGGCCAGTTTGAATTGGATGTAAACTCGAGTTTACATCCAATTCAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016620.2-340s1c1
Sequence:CCGGGACGAGGTTTACATTCTCCGACTCGAGTCGGAGAATGTAAACCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016620.2-335s1c1
Sequence:CCGGGTGCTGACGAGGTTTACATTCCTCGAGGAATGTAAACCTCGTCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_016620.2-287s1c1
Sequence:CCGGCAAGGTCAAGATCTGGAAGCACTCGAGTGCTTCCAGATCTTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_016620.2-478s1c1
Sequence:CCGGGAAGTCACGTCACTACTTAAACTCGAGTTTAAGTAGTGACGTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_016620.2-409s1c1
Sequence:CCGGGACTGGATTAAGCACTTACAACTCGAGTTGTAAGTGCTTAATCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016620.2-508s21c1
Sequence:CCGGTCCATTACAGAAACTTCATTTCTCGAGAAATGAAGTTTCTGTAATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016620.2-859s21c1
Sequence:CCGGACAGACTTATTGGACAATTATCTCGAGATAATTGTCCAATAAGTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016620.2-529s21c1
Sequence:CCGGTCTCTACTAATGGCCGAAGCACTCGAGTGCTTCGGCCATTAGTAGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016620.2-316s21c1
Sequence:CCGCATGCTAACATTACCTCATGGTCTCGAGACCATGAGGTAATGTTAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016620
VALIDATED
ZNF644 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 644
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121698    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_016620.2-581s1c1
Sequence:CCGGCCAGTTTGAATTGGATGTAAACTCGAGTTTACATCCAATTCAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016620.2-340s1c1
Sequence:CCGGGACGAGGTTTACATTCTCCGACTCGAGTCGGAGAATGTAAACCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016620.2-335s1c1
Sequence:CCGGGTGCTGACGAGGTTTACATTCCTCGAGGAATGTAAACCTCGTCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_016620.2-287s1c1
Sequence:CCGGCAAGGTCAAGATCTGGAAGCACTCGAGTGCTTCCAGATCTTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_016620.2-478s1c1
Sequence:CCGGGAAGTCACGTCACTACTTAAACTCGAGTTTAAGTAGTGACGTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_016620.2-409s1c1
Sequence:CCGGGACTGGATTAAGCACTTACAACTCGAGTTGTAAGTGCTTAATCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016620.2-508s21c1
Sequence:CCGGTCCATTACAGAAACTTCATTTCTCGAGAAATGAAGTTTCTGTAATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016620.2-859s21c1
Sequence:CCGGACAGACTTATTGGACAATTATCTCGAGATAATTGTCCAATAAGTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016620.2-529s21c1
Sequence:CCGGTCTCTACTAATGGCCGAAGCACTCGAGTGCTTCGGCCATTAGTAGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016620.2-316s21c1
Sequence:CCGCATGCTAACATTACCTCATGGTCTCGAGACCATGAGGTAATGTTAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016620
VALIDATED
ZNF644 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 644
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121698    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_016620.2-581s1c1
Sequence:CCGGCCAGTTTGAATTGGATGTAAACTCGAGTTTACATCCAATTCAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016620.2-340s1c1
Sequence:CCGGGACGAGGTTTACATTCTCCGACTCGAGTCGGAGAATGTAAACCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016620.2-335s1c1
Sequence:CCGGGTGCTGACGAGGTTTACATTCCTCGAGGAATGTAAACCTCGTCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_016620.2-287s1c1
Sequence:CCGGCAAGGTCAAGATCTGGAAGCACTCGAGTGCTTCCAGATCTTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_016620.2-478s1c1
Sequence:CCGGGAAGTCACGTCACTACTTAAACTCGAGTTTAAGTAGTGACGTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_016620.2-409s1c1
Sequence:CCGGGACTGGATTAAGCACTTACAACTCGAGTTGTAAGTGCTTAATCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016620.2-508s21c1
Sequence:CCGGTCCATTACAGAAACTTCATTTCTCGAGAAATGAAGTTTCTGTAATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016620.2-859s21c1
Sequence:CCGGACAGACTTATTGGACAATTATCTCGAGATAATTGTCCAATAAGTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016620.2-529s21c1
Sequence:CCGGTCTCTACTAATGGCCGAAGCACTCGAGTGCTTCGGCCATTAGTAGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016620.2-316s21c1
Sequence:CCGCATGCTAACATTACCTCATGGTCTCGAGACCATGAGGTAATGTTAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks