EMAIL THIS PAGE TO A FRIEND

ZNF645

zinc finger protein 645

Synonyms: HAKAIL
Species: Human ZNF645(158506)
UniProtKB ID: Q8N7E2, A0AV29, A0AV31, Q6DJY9
Gene ID:
Human(158506) Summary: This gene encodes a member of the zinc finger domain-containing protein family. This family member contains both a RING-type and a C2H2-type of zinc finger domain, and it may function as an E3 ubiquitin-protein ligase. Protein localization suggests a role in human sperm production and quality control. [provided by RefSeq, Aug 2011]
35 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152577 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152577 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152577 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119711 MISSION® esiRNA esiRNA human ZNF645 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152577 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152577 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123900 predicted 503
2 SASI_Hs01_00123901 predicted 361
3 SASI_Hs01_00123902 predicted 1119
4 SASI_Hs01_00123904 predicted 567
5 SASI_Hs02_00366394 predicted 640
6 SASI_Hs01_00123906 predicted 411
7 SASI_Hs01_00123907 predicted 1160
8 SASI_Hs01_00123908 predicted 1099
9 SASI_Hs01_00123909 predicted 963
10 SASI_Hs02_00366395 predicted 1108
11 SASI_Hs01_00123903 predicted 820
12 SASI_Hs01_00123905 predicted 355
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152577
ZNF645 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 645
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152577.2-616s21c1
Sequence:CCGGACTACCGTCTGTGCAACATATCTCGAGATATGTTGCACAGACGGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152577.2-104s21c1
Sequence:CCGGTACTACTCTAAAGGAGTTAAACTCGAGTTTAACTCCTTTAGAGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152577.2-301s21c1
Sequence:CCGGATATGACAAAGTCGGATATAACTCGAGTTATATCCGACTTTGTCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152577.1-351s1c1
Sequence:CCGGGCTGAGAATTGAGGCGCATAACTCGAGTTATGCGCCTCAATTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152577.1-1308s1c1
Sequence:CCGGGAGAAGACATAGACGGTATTACTCGAGTAATACCGTCTATGTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152577.1-720s1c1
Sequence:CCGGCCAGTGGGAAACCGTTAGTATCTCGAGATACTAACGGTTTCCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152577.1-1011s1c1
Sequence:CCGGCGATCCATCATCTGGATATATCTCGAGATATATCCAGATGATGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152577.1-405s1c1
Sequence:CCGGGCAGTGCAAGAGAACATACTTCTCGAGAAGTATGTTCTCTTGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152577
ZNF645 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 645
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152577.2-616s21c1
Sequence:CCGGACTACCGTCTGTGCAACATATCTCGAGATATGTTGCACAGACGGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152577.2-104s21c1
Sequence:CCGGTACTACTCTAAAGGAGTTAAACTCGAGTTTAACTCCTTTAGAGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152577.2-301s21c1
Sequence:CCGGATATGACAAAGTCGGATATAACTCGAGTTATATCCGACTTTGTCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152577.1-351s1c1
Sequence:CCGGGCTGAGAATTGAGGCGCATAACTCGAGTTATGCGCCTCAATTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152577.1-1308s1c1
Sequence:CCGGGAGAAGACATAGACGGTATTACTCGAGTAATACCGTCTATGTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152577.1-720s1c1
Sequence:CCGGCCAGTGGGAAACCGTTAGTATCTCGAGATACTAACGGTTTCCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152577.1-1011s1c1
Sequence:CCGGCGATCCATCATCTGGATATATCTCGAGATATATCCAGATGATGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152577.1-405s1c1
Sequence:CCGGGCAGTGCAAGAGAACATACTTCTCGAGAAGTATGTTCTCTTGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152577
ZNF645 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 645
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152577.2-616s21c1
Sequence:CCGGACTACCGTCTGTGCAACATATCTCGAGATATGTTGCACAGACGGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152577.2-104s21c1
Sequence:CCGGTACTACTCTAAAGGAGTTAAACTCGAGTTTAACTCCTTTAGAGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152577.2-301s21c1
Sequence:CCGGATATGACAAAGTCGGATATAACTCGAGTTATATCCGACTTTGTCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152577.1-351s1c1
Sequence:CCGGGCTGAGAATTGAGGCGCATAACTCGAGTTATGCGCCTCAATTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152577.1-1308s1c1
Sequence:CCGGGAGAAGACATAGACGGTATTACTCGAGTAATACCGTCTATGTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152577.1-720s1c1
Sequence:CCGGCCAGTGGGAAACCGTTAGTATCTCGAGATACTAACGGTTTCCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152577.1-1011s1c1
Sequence:CCGGCGATCCATCATCTGGATATATCTCGAGATATATCCAGATGATGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152577.1-405s1c1
Sequence:CCGGGCAGTGCAAGAGAACATACTTCTCGAGAAGTATGTTCTCTTGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks