EMAIL THIS PAGE TO A FRIEND

ZNF646

zinc finger protein 646

UniProtKB ID: O15015, Q8IVD8
Gene ID:
Horse(100063391) zinc finger protein 646
domestic cat(101090069) zinc finger protein 646
dog(489922) zinc finger protein 646
domestic guinea pig(100717040) zinc finger protein 646
naked mole-rat(101710366) zinc finger protein 646
Domestic Rabbit(100353128) zinc finger protein 646
cow(783820) zinc finger protein 646
sheep(101104032) zinc finger protein 646
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102927 Anti-ZNF646 antibody produced in rabbit affinity isolated antibody canine, horse, mouse, human
western blot pricing
HPA042364 Anti-ZNF646 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014699 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014699 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014699 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146171 MISSION® esiRNA esiRNA human ZNF646 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014699 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014699 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044874 predicted 2511
2 SASI_Hs02_00346104 predicted 1978
3 SASI_Hs01_00044875 predicted 2455
4 SASI_Hs01_00044876 predicted 1136
5 SASI_Hs02_00346105 predicted 4041
6 SASI_Hs02_00346106 predicted 909
7 SASI_Hs02_00346107 predicted 5008
8 SASI_Hs01_00044880 predicted 918
9 SASI_Hs01_00044881 predicted 1084
10 SASI_Hs01_00044882 predicted 3285
11 SASI_Hs01_00044877 predicted 1273
12 SASI_Hs01_00044878 predicted 3501
13 SASI_Hs01_00044879 predicted 1090
14 SASI_Hs01_00044883 predicted 2005
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014699
ZNF646 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 646
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014699.2-2364s1c1
Sequence:CCGGCGGGAGCTAGAAGACAATGAACTCGAGTTCATTGTCTTCTAGCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014699.2-904s1c1
Sequence:CCGGTGGAACAGTATCTGGCTGAATCTCGAGATTCAGCCAGATACTGTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014699.2-1436s1c1
Sequence:CCGGGAGCCTCATCAACCATCGAAACTCGAGTTTCGATGGTTGATGAGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014699.2-3288s1c1
Sequence:CCGGGACAGTGTCTTGGAGGACATACTCGAGTATGTCCTCCAAGACACTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014699.2-4513s1c1
Sequence:CCGGGCCAGGGACTAGAGACCCAATCTCGAGATTGGGTCTCTAGTCCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014699.3-2759s21c1
Sequence:CCGGTCTGACTGTGGGCATTCTTTCCTCGAGGAAAGAATGCCCACAGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014699.3-4944s21c1
Sequence:CCGGACAAGACAGACCGACACTATTCTCGAGAATAGTGTCGGTCTGTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014699.3-2512s21c1
Sequence:CCGCTGAGAGGGATGAGACCCATTTCTCGAGAAATGGGTCTCATCCCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014699.3-2573s21c1
Sequence:CCGGGAAAGGAAGGATGCCAGTTTACTCGAGTAAACTGGCATCCTTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014699
ZNF646 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 646
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014699.2-2364s1c1
Sequence:CCGGCGGGAGCTAGAAGACAATGAACTCGAGTTCATTGTCTTCTAGCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014699.2-904s1c1
Sequence:CCGGTGGAACAGTATCTGGCTGAATCTCGAGATTCAGCCAGATACTGTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014699.2-1436s1c1
Sequence:CCGGGAGCCTCATCAACCATCGAAACTCGAGTTTCGATGGTTGATGAGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014699.2-3288s1c1
Sequence:CCGGGACAGTGTCTTGGAGGACATACTCGAGTATGTCCTCCAAGACACTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014699.2-4513s1c1
Sequence:CCGGGCCAGGGACTAGAGACCCAATCTCGAGATTGGGTCTCTAGTCCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014699.3-2759s21c1
Sequence:CCGGTCTGACTGTGGGCATTCTTTCCTCGAGGAAAGAATGCCCACAGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014699.3-4944s21c1
Sequence:CCGGACAAGACAGACCGACACTATTCTCGAGAATAGTGTCGGTCTGTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014699.3-2512s21c1
Sequence:CCGCTGAGAGGGATGAGACCCATTTCTCGAGAAATGGGTCTCATCCCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014699.3-2573s21c1
Sequence:CCGGGAAAGGAAGGATGCCAGTTTACTCGAGTAAACTGGCATCCTTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014699
ZNF646 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 646
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014699.2-2364s1c1
Sequence:CCGGCGGGAGCTAGAAGACAATGAACTCGAGTTCATTGTCTTCTAGCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014699.2-904s1c1
Sequence:CCGGTGGAACAGTATCTGGCTGAATCTCGAGATTCAGCCAGATACTGTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014699.2-1436s1c1
Sequence:CCGGGAGCCTCATCAACCATCGAAACTCGAGTTTCGATGGTTGATGAGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014699.2-3288s1c1
Sequence:CCGGGACAGTGTCTTGGAGGACATACTCGAGTATGTCCTCCAAGACACTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014699.2-4513s1c1
Sequence:CCGGGCCAGGGACTAGAGACCCAATCTCGAGATTGGGTCTCTAGTCCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014699.3-2759s21c1
Sequence:CCGGTCTGACTGTGGGCATTCTTTCCTCGAGGAAAGAATGCCCACAGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014699.3-4944s21c1
Sequence:CCGGACAAGACAGACCGACACTATTCTCGAGAATAGTGTCGGTCTGTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014699.3-2512s21c1
Sequence:CCGCTGAGAGGGATGAGACCCATTTCTCGAGAAATGGGTCTCATCCCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014699.3-2573s21c1
Sequence:CCGGGAAAGGAAGGATGCCAGTTTACTCGAGTAAACTGGCATCCTTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks