EMAIL THIS PAGE TO A FRIEND

ZNF648

zinc finger protein 648

UniProtKB ID: Q5T619, B2RP16
Gene ID:
dog(490306) zinc finger protein 648
domestic cat(101093738) zinc finger protein 648
Horse(100051231) zinc finger protein 648
cow(539756) zinc finger protein 648
sheep(101102747) zinc finger protein 648
naked mole-rat(101723487) zinc finger protein 648
domestic guinea pig(101789246) zinc finger protein 648
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001009992 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001009992 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001009992 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009992 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009992 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194793 predicted 1676
2 SASI_Hs01_00194794 predicted 579
3 SASI_Hs01_00194795 predicted 1653
4 SASI_Hs02_00305766 predicted 800
5 SASI_Hs01_00194796 predicted 485
6 SASI_Hs01_00194797 predicted 1235
7 SASI_Hs01_00194798 predicted 1556
8 SASI_Hs01_00194799 predicted 1122
9 SASI_Hs01_00194800 predicted 439
10 SASI_Hs01_00194801 predicted 744
11 SASI_Hs01_00194802 predicted 1542
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009992
ZNF648 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 648
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009992.1-1768s1c1
Sequence:CCGGCCAGCACATACGAATGCACAACTCGAGTTGTGCATTCGTATGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009992.1-601s1c1
Sequence:CCGGACACAAATTGTTAGGTCAGATCTCGAGATCTGACCTAACAATTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009992.1-2777s1c1
Sequence:CCGGGCCCATTTACAGAGAGACATACTCGAGTATGTCTCTCTGTAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009992.1-488s1c1
Sequence:CCGGCCAGTGGAAATGTCTGGGAAACTCGAGTTTCCCAGACATTTCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009992.1-1273s1c1
Sequence:CCGGCAACATGCACAGCAACAATAACTCGAGTTATTGTTGCTGTGCATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009992
ZNF648 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 648
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009992.1-1768s1c1
Sequence:CCGGCCAGCACATACGAATGCACAACTCGAGTTGTGCATTCGTATGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009992.1-601s1c1
Sequence:CCGGACACAAATTGTTAGGTCAGATCTCGAGATCTGACCTAACAATTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009992.1-2777s1c1
Sequence:CCGGGCCCATTTACAGAGAGACATACTCGAGTATGTCTCTCTGTAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009992.1-488s1c1
Sequence:CCGGCCAGTGGAAATGTCTGGGAAACTCGAGTTTCCCAGACATTTCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009992.1-1273s1c1
Sequence:CCGGCAACATGCACAGCAACAATAACTCGAGTTATTGTTGCTGTGCATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009992
ZNF648 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 648
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009992.1-1768s1c1
Sequence:CCGGCCAGCACATACGAATGCACAACTCGAGTTGTGCATTCGTATGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009992.1-601s1c1
Sequence:CCGGACACAAATTGTTAGGTCAGATCTCGAGATCTGACCTAACAATTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009992.1-2777s1c1
Sequence:CCGGGCCCATTTACAGAGAGACATACTCGAGTATGTCTCTCTGTAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009992.1-488s1c1
Sequence:CCGGCCAGTGGAAATGTCTGGGAAACTCGAGTTTCCCAGACATTTCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009992.1-1273s1c1
Sequence:CCGGCAACATGCACAGCAACAATAACTCGAGTTATTGTTGCTGTGCATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks