EMAIL THIS PAGE TO A FRIEND

ZNF649

zinc finger protein 649

Species: Human ZNF649(65251)
UniProtKB ID: Q9BS31, A8MYJ5, B2RDC4, Q9H9N2
Gene ID:
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023074 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023074 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023074 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120631 MISSION® esiRNA esiRNA human ZNF649 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023074 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235116 predicted 1085
2 SASI_Hs01_00235118 predicted 640
3 SASI_Hs01_00235119 predicted 1500
4 SASI_Hs01_00235120 predicted 1107
5 SASI_Hs01_00235121 predicted 1080
6 SASI_Hs01_00235122 predicted 1079
7 SASI_Hs01_00235123 predicted 573
8 SASI_Hs01_00235124 predicted 459
9 SASI_Hs01_00235125 predicted 1041
10 SASI_Hs02_00356314 predicted 1089
11 SASI_Hs01_00235117 predicted 1300
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023074
VALIDATED
ZNF649 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 649
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023074.2-1195s1c1
Sequence:CCGGGCGAACTCATACAGGAGAGAACTCGAGTTCTCTCCTGTATGAGTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_023074.2-497s1c1
Sequence:CCGGGCCCACCCAGAAATTGAGAAACTCGAGTTTCTCAATTTCTGGGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023074.2-1668s1c1
Sequence:CCGGCCACAGCAAGTCACAGCTTAACTCGAGTTAAGCTGTGACTTGCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023074.2-698s21c1
Sequence:CCGGGAACAAATGCCTACGGAAATTCTCGAGAATTTCCGTAGGCATTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023074.2-1254s21c1
Sequence:CCGGAGAAGGGCAATCTCAACATACCTCGAGGTATGTTGAGATTGCCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023074
VALIDATED
ZNF649 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 649
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023074.2-1195s1c1
Sequence:CCGGGCGAACTCATACAGGAGAGAACTCGAGTTCTCTCCTGTATGAGTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_023074.2-497s1c1
Sequence:CCGGGCCCACCCAGAAATTGAGAAACTCGAGTTTCTCAATTTCTGGGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023074.2-1668s1c1
Sequence:CCGGCCACAGCAAGTCACAGCTTAACTCGAGTTAAGCTGTGACTTGCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023074.2-698s21c1
Sequence:CCGGGAACAAATGCCTACGGAAATTCTCGAGAATTTCCGTAGGCATTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023074.2-1254s21c1
Sequence:CCGGAGAAGGGCAATCTCAACATACCTCGAGGTATGTTGAGATTGCCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023074
VALIDATED
ZNF649 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 649
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023074.2-1195s1c1
Sequence:CCGGGCGAACTCATACAGGAGAGAACTCGAGTTCTCTCCTGTATGAGTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_023074.2-497s1c1
Sequence:CCGGGCCCACCCAGAAATTGAGAAACTCGAGTTTCTCAATTTCTGGGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023074.2-1668s1c1
Sequence:CCGGCCACAGCAAGTCACAGCTTAACTCGAGTTAAGCTGTGACTTGCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023074.2-698s21c1
Sequence:CCGGGAACAAATGCCTACGGAAATTCTCGAGAATTTCCGTAGGCATTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023074.2-1254s21c1
Sequence:CCGGAGAAGGGCAATCTCAACATACCTCGAGGTATGTTGAGATTGCCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks