EMAIL THIS PAGE TO A FRIEND

ZNF652

zinc finger protein 652

UniProtKB ID: Q9Y2D9, A4QPD9, Q5H9Q0
Gene ID:
Zebrafish(557571) zinc finger protein 652
Horse(100055999) zinc finger protein 652
domestic cat(101094965) zinc finger protein 652
dog(491070) zinc finger protein 652
chicken(419987) zinc finger protein 652
domestic guinea pig(100716902) zinc finger protein 652
naked mole-rat(101723062) zinc finger protein 652
Domestic Rabbit(100349345) zinc finger protein 652
cow(511703) zinc finger protein 652
sheep(101112073) zinc finger protein 652
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014897 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014897 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014897 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128941 MISSION® esiRNA esiRNA human ZNF652 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014897 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014897 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346526 predicted 601
2 SASI_Hs01_00231291 predicted 338
3 SASI_Hs01_00231292 predicted 1143
4 SASI_Hs01_00231293 predicted 1424
5 SASI_Hs01_00231294 predicted 740
6 SASI_Hs01_00231295 predicted 1526
7 SASI_Hs01_00231296 predicted 511
8 SASI_Hs01_00231297 predicted 1320
9 SASI_Hs02_00346527 predicted 1351
10 SASI_Hs01_00231298 predicted 551
11 SASI_Hs01_00231299 predicted 1120
12 SASI_Hs01_00231300 predicted 1428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014897
VALIDATED
ZNF652 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 652
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014897.1-2514s21c1
Sequence:CCGGATCGGGAAGGCTGTGAGATTACTCGAGTAATCTCACAGCCTTCCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014897.1-672s21c1
Sequence:CCGGTAGTGGAGGTAAACCTTAATACTCGAGTATTAAGGTTTACCTCCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014897.1-1105s21c1
Sequence:CCGGGCACATGAACGTTACTCATAGCTCGAGCTATGAGTAACGTTCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014897.1-454s21c1
Sequence:CCGGCCTGTCCACCAAAGTGTACAACTCGAGTTGTACACTTTGGTGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014897.1-1127s21c1
Sequence:CCGGCGCATGCAGATTTGTGATAAACTCGAGTTTATCACAAATCTGCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014897.1-454s1c1
Sequence:CCGGCCTGTCCACCAAAGTGTACAACTCGAGTTGTACACTTTGGTGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014897.1-741s1c1
Sequence:CCGGCCAAAGAGACTCCTGTTCTTACTCGAGTAAGAACAGGAGTCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014897.1-1379s1c1
Sequence:CCGGGACATGCCATTTACATGCGAACTCGAGTTCGCATGTAAATGGCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014897.1-3381s1c1
Sequence:CCGGGCTGAGAAATTCAGATGAGAACTCGAGTTCTCATCTGAATTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014897.1-1127s1c1
Sequence:CCGGCGCATGCAGATTTGTGATAAACTCGAGTTTATCACAAATCTGCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014897.1-4958s1c1
Sequence:CCGGCCACAGAATCAACCATTTCATCTCGAGATGAAATGGTTGATTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014897.1-1531s1c1
Sequence:CCGGGAGCATTCATATTGGGCACAACTCGAGTTGTGCCCAATATGAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153542    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014897.1-3546s1c1
Sequence:CCGGCCAGCATTCTTAGGCGATAAACTCGAGTTTATCGCCTAAGAATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014897.1-2347s1c1
Sequence:CCGGCCACTGAACTAAAGCCCAATTCTCGAGAATTGGGCTTTAGTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014897
VALIDATED
ZNF652 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 652
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014897.1-2514s21c1
Sequence:CCGGATCGGGAAGGCTGTGAGATTACTCGAGTAATCTCACAGCCTTCCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014897.1-672s21c1
Sequence:CCGGTAGTGGAGGTAAACCTTAATACTCGAGTATTAAGGTTTACCTCCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014897.1-1105s21c1
Sequence:CCGGGCACATGAACGTTACTCATAGCTCGAGCTATGAGTAACGTTCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014897.1-454s21c1
Sequence:CCGGCCTGTCCACCAAAGTGTACAACTCGAGTTGTACACTTTGGTGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014897.1-1127s21c1
Sequence:CCGGCGCATGCAGATTTGTGATAAACTCGAGTTTATCACAAATCTGCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014897.1-454s1c1
Sequence:CCGGCCTGTCCACCAAAGTGTACAACTCGAGTTGTACACTTTGGTGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014897.1-741s1c1
Sequence:CCGGCCAAAGAGACTCCTGTTCTTACTCGAGTAAGAACAGGAGTCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014897.1-1379s1c1
Sequence:CCGGGACATGCCATTTACATGCGAACTCGAGTTCGCATGTAAATGGCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014897.1-3381s1c1
Sequence:CCGGGCTGAGAAATTCAGATGAGAACTCGAGTTCTCATCTGAATTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014897.1-1127s1c1
Sequence:CCGGCGCATGCAGATTTGTGATAAACTCGAGTTTATCACAAATCTGCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014897.1-4958s1c1
Sequence:CCGGCCACAGAATCAACCATTTCATCTCGAGATGAAATGGTTGATTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014897.1-1531s1c1
Sequence:CCGGGAGCATTCATATTGGGCACAACTCGAGTTGTGCCCAATATGAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153542    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014897.1-3546s1c1
Sequence:CCGGCCAGCATTCTTAGGCGATAAACTCGAGTTTATCGCCTAAGAATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014897.1-2347s1c1
Sequence:CCGGCCACTGAACTAAAGCCCAATTCTCGAGAATTGGGCTTTAGTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014897
VALIDATED
ZNF652 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 652
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014897.1-2514s21c1
Sequence:CCGGATCGGGAAGGCTGTGAGATTACTCGAGTAATCTCACAGCCTTCCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014897.1-672s21c1
Sequence:CCGGTAGTGGAGGTAAACCTTAATACTCGAGTATTAAGGTTTACCTCCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014897.1-1105s21c1
Sequence:CCGGGCACATGAACGTTACTCATAGCTCGAGCTATGAGTAACGTTCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014897.1-454s21c1
Sequence:CCGGCCTGTCCACCAAAGTGTACAACTCGAGTTGTACACTTTGGTGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014897.1-1127s21c1
Sequence:CCGGCGCATGCAGATTTGTGATAAACTCGAGTTTATCACAAATCTGCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014897.1-454s1c1
Sequence:CCGGCCTGTCCACCAAAGTGTACAACTCGAGTTGTACACTTTGGTGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014897.1-741s1c1
Sequence:CCGGCCAAAGAGACTCCTGTTCTTACTCGAGTAAGAACAGGAGTCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014897.1-1379s1c1
Sequence:CCGGGACATGCCATTTACATGCGAACTCGAGTTCGCATGTAAATGGCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014897.1-3381s1c1
Sequence:CCGGGCTGAGAAATTCAGATGAGAACTCGAGTTCTCATCTGAATTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014897.1-1127s1c1
Sequence:CCGGCGCATGCAGATTTGTGATAAACTCGAGTTTATCACAAATCTGCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014897.1-4958s1c1
Sequence:CCGGCCACAGAATCAACCATTTCATCTCGAGATGAAATGGTTGATTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014897.1-1531s1c1
Sequence:CCGGGAGCATTCATATTGGGCACAACTCGAGTTGTGCCCAATATGAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153542    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014897.1-3546s1c1
Sequence:CCGGCCAGCATTCTTAGGCGATAAACTCGAGTTTATCGCCTAAGAATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014897.1-2347s1c1
Sequence:CCGGCCACTGAACTAAAGCCCAATTCTCGAGAATTGGGCTTTAGTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks