EMAIL THIS PAGE TO A FRIEND

ZNF653

zinc finger protein 653

Synonyms: E430039K05Rik ZIP67
UniProtKB ID: Q96CK0, Q96AS7
Gene ID:
domestic cat(101082130) zinc finger protein 653
dog(484939) zinc finger protein 653
cow(516232) zinc finger protein 653
sheep(101121347) zinc finger protein 653
naked mole-rat(101715784) zinc finger protein 653
domestic guinea pig(100722027) zinc finger protein 653
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138783 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138783 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138783 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138783 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138783 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046835 predicted 401
2 SASI_Hs01_00046836 predicted 1507
3 SASI_Hs01_00046837 predicted 995
4 SASI_Hs01_00046838 predicted 657
5 SASI_Hs01_00046839 predicted 1227
6 SASI_Hs01_00046840 predicted 1525
7 SASI_Hs01_00046841 predicted 1188
8 SASI_Hs01_00046842 predicted 1611
9 SASI_Hs01_00046843 predicted 1500
10 SASI_Hs01_00046844 predicted 577
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138783
ZNF653 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 653
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138783.1-1518s1c1
Sequence:CCGGCGTCAATCTTGTGCATCGGAACTCGAGTTCCGATGCACAAGATTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138783.1-1656s1c1
Sequence:CCGGCGGCAAGTCCTTCAAGAGGAACTCGAGTTCCTCTTGAAGGACTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138783.1-1362s1c1
Sequence:CCGGGTCAGCCATCATCTATGAAATCTCGAGATTTCATAGATGATGGCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138783.1-1804s1c1
Sequence:CCGGCAGTACAACTTCACGTGCGATCTCGAGATCGCACGTGAAGTTGTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138783.1-1207s1c1
Sequence:CCGGGCAGGCATCGAGACCAAGAAACTCGAGTTTCTTGGTCTCGATGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138783.2-1566s21c1
Sequence:CCGGTGTGGCAAGAAGTTCTATTTACTCGAGTAAATAGAACTTCTTGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138783.2-1501s21c1
Sequence:CCGGGCTTCCAGAACCACGTCAATCCTCGAGGATTGACGTGGTTCTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138783.2-1000s21c1
Sequence:CCGGGCTCACAGGTGATCATCATTGCTCGAGCAATGATGATCACCTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138783.2-1230s21c1
Sequence:CCGGGAGGACCTGTGCTTGCTAAAGCTCGAGCTTTAGCAAGCACAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138783
ZNF653 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 653
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138783.1-1518s1c1
Sequence:CCGGCGTCAATCTTGTGCATCGGAACTCGAGTTCCGATGCACAAGATTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138783.1-1656s1c1
Sequence:CCGGCGGCAAGTCCTTCAAGAGGAACTCGAGTTCCTCTTGAAGGACTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138783.1-1362s1c1
Sequence:CCGGGTCAGCCATCATCTATGAAATCTCGAGATTTCATAGATGATGGCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138783.1-1804s1c1
Sequence:CCGGCAGTACAACTTCACGTGCGATCTCGAGATCGCACGTGAAGTTGTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138783.1-1207s1c1
Sequence:CCGGGCAGGCATCGAGACCAAGAAACTCGAGTTTCTTGGTCTCGATGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138783.2-1566s21c1
Sequence:CCGGTGTGGCAAGAAGTTCTATTTACTCGAGTAAATAGAACTTCTTGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138783.2-1501s21c1
Sequence:CCGGGCTTCCAGAACCACGTCAATCCTCGAGGATTGACGTGGTTCTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138783.2-1000s21c1
Sequence:CCGGGCTCACAGGTGATCATCATTGCTCGAGCAATGATGATCACCTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138783.2-1230s21c1
Sequence:CCGGGAGGACCTGTGCTTGCTAAAGCTCGAGCTTTAGCAAGCACAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138783
ZNF653 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 653
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138783.1-1518s1c1
Sequence:CCGGCGTCAATCTTGTGCATCGGAACTCGAGTTCCGATGCACAAGATTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138783.1-1656s1c1
Sequence:CCGGCGGCAAGTCCTTCAAGAGGAACTCGAGTTCCTCTTGAAGGACTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138783.1-1362s1c1
Sequence:CCGGGTCAGCCATCATCTATGAAATCTCGAGATTTCATAGATGATGGCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138783.1-1804s1c1
Sequence:CCGGCAGTACAACTTCACGTGCGATCTCGAGATCGCACGTGAAGTTGTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138783.1-1207s1c1
Sequence:CCGGGCAGGCATCGAGACCAAGAAACTCGAGTTTCTTGGTCTCGATGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138783.2-1566s21c1
Sequence:CCGGTGTGGCAAGAAGTTCTATTTACTCGAGTAAATAGAACTTCTTGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138783.2-1501s21c1
Sequence:CCGGGCTTCCAGAACCACGTCAATCCTCGAGGATTGACGTGGTTCTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138783.2-1000s21c1
Sequence:CCGGGCTCACAGGTGATCATCATTGCTCGAGCAATGATGATCACCTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138783.2-1230s21c1
Sequence:CCGGGAGGACCTGTGCTTGCTAAAGCTCGAGCTTTAGCAAGCACAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks