EMAIL THIS PAGE TO A FRIEND

ZNF654

zinc finger protein 654

UniProtKB ID: Q8IZM8, Q9H791, Q9NV14
Gene ID:
domestic guinea pig(100735644) zinc finger protein 654
naked mole-rat(101720932) zinc finger protein 654
cow(100335242) zinc finger protein 654
sheep(101102449) zinc finger protein 654
Zebrafish(100004980) zinc finger protein 654
domestic cat(101085064) zinc finger protein 654
dog(487673) zinc finger protein 654
chicken(418428) zinc finger protein 654
155 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018293 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018293 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018293 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU011621 MISSION® esiRNA esiRNA targeting human ZNF654 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018293 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018293 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014124 predicted 862
2 SASI_Hs01_00014125 predicted 663
3 SASI_Hs02_00351686 predicted 323
4 SASI_Hs02_00351687 predicted 1505
5 SASI_Hs02_00351688 predicted 1512
6 SASI_Hs02_00351689 predicted 970
7 SASI_Hs01_00014127 predicted 441
8 SASI_Hs01_00014128 predicted 476
9 SASI_Hs02_00351690 predicted 1464
10 SASI_Hs02_00351691 predicted 1070
11 SASI_Hs01_00014123 predicted 1044
12 SASI_Hs01_00014126 predicted 863
13 SASI_Hs01_00014129 predicted 982
14 SASI_Hs01_00014130 predicted 234
15 SASI_Hs01_00014131 predicted 1002
16 SASI_Hs01_00014132 predicted 772
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018293
VALIDATED
ZNF654 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 654
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018293.2-809s21c1
Sequence:CCGGCTTGGTTGTGTCCGGATATTTCTCGAGAAATATCCGGACACAACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018293.2-2897s21c1
Sequence:CCGGATCTAAGTACAGTCCTATTAACTCGAGTTAATAGGACTGTACTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018293.2-1791s21c1
Sequence:GTACCGGCTGATCAAGATAACGTGTATACTCGAGTATACACGTTATCTTGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018293.2-1287s21c1
Sequence:GTACCGGTGCCAGTTTCTACTAGCAAATCTCGAGATTTGCTAGTAGAAACTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018293.2-864s21c1
Sequence:CCGGCCGTACATCCAACCGATTTAACTCGAGTTAAATCGGTTGGATGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018293.1-932s1c1
Sequence:CCGGGAACATGAAGCTCAACACTATCTCGAGATAGTGTTGAGCTTCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018293.1-452s1c1
Sequence:CCGGGAAGAGGATGAAGAAGGTGATCTCGAGATCACCTTCTTCATCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018293.1-1990s1c1
Sequence:CCGGGCAGCATGTTCAGTTTCGCTTCTCGAGAAGCGAAACTGAACATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018293.1-1499s1c1
Sequence:CCGGCCTCCCAGTTACCTTGATGAACTCGAGTTCATCAAGGTAACTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018293.1-651s1c1
Sequence:CCGGCCGTACATCCAACCGATTTAACTCGAGTTAAATCGGTTGGATGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018293.1-561s1c1
Sequence:CCGGCCACAGATCAAGAAGGAAACTCTCGAGAGTTTCCTTCTTGATCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018293
VALIDATED
ZNF654 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 654
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018293.2-809s21c1
Sequence:CCGGCTTGGTTGTGTCCGGATATTTCTCGAGAAATATCCGGACACAACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018293.2-2897s21c1
Sequence:CCGGATCTAAGTACAGTCCTATTAACTCGAGTTAATAGGACTGTACTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018293.2-1791s21c1
Sequence:GTACCGGCTGATCAAGATAACGTGTATACTCGAGTATACACGTTATCTTGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018293.2-1287s21c1
Sequence:GTACCGGTGCCAGTTTCTACTAGCAAATCTCGAGATTTGCTAGTAGAAACTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018293.2-864s21c1
Sequence:CCGGCCGTACATCCAACCGATTTAACTCGAGTTAAATCGGTTGGATGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018293.1-932s1c1
Sequence:CCGGGAACATGAAGCTCAACACTATCTCGAGATAGTGTTGAGCTTCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018293.1-452s1c1
Sequence:CCGGGAAGAGGATGAAGAAGGTGATCTCGAGATCACCTTCTTCATCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018293.1-1990s1c1
Sequence:CCGGGCAGCATGTTCAGTTTCGCTTCTCGAGAAGCGAAACTGAACATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018293.1-1499s1c1
Sequence:CCGGCCTCCCAGTTACCTTGATGAACTCGAGTTCATCAAGGTAACTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018293.1-651s1c1
Sequence:CCGGCCGTACATCCAACCGATTTAACTCGAGTTAAATCGGTTGGATGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018293.1-561s1c1
Sequence:CCGGCCACAGATCAAGAAGGAAACTCTCGAGAGTTTCCTTCTTGATCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018293
VALIDATED
ZNF654 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 654
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018293.2-809s21c1
Sequence:CCGGCTTGGTTGTGTCCGGATATTTCTCGAGAAATATCCGGACACAACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018293.2-2897s21c1
Sequence:CCGGATCTAAGTACAGTCCTATTAACTCGAGTTAATAGGACTGTACTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018293.2-1791s21c1
Sequence:GTACCGGCTGATCAAGATAACGTGTATACTCGAGTATACACGTTATCTTGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018293.2-1287s21c1
Sequence:GTACCGGTGCCAGTTTCTACTAGCAAATCTCGAGATTTGCTAGTAGAAACTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018293.2-864s21c1
Sequence:CCGGCCGTACATCCAACCGATTTAACTCGAGTTAAATCGGTTGGATGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018293.1-932s1c1
Sequence:CCGGGAACATGAAGCTCAACACTATCTCGAGATAGTGTTGAGCTTCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018293.1-452s1c1
Sequence:CCGGGAAGAGGATGAAGAAGGTGATCTCGAGATCACCTTCTTCATCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018293.1-1990s1c1
Sequence:CCGGGCAGCATGTTCAGTTTCGCTTCTCGAGAAGCGAAACTGAACATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018293.1-1499s1c1
Sequence:CCGGCCTCCCAGTTACCTTGATGAACTCGAGTTCATCAAGGTAACTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018293.1-651s1c1
Sequence:CCGGCCGTACATCCAACCGATTTAACTCGAGTTAAATCGGTTGGATGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018293.1-561s1c1
Sequence:CCGGCCACAGATCAAGAAGGAAACTCTCGAGAGTTTCCTTCTTGATCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks