EMAIL THIS PAGE TO A FRIEND

ZNF655

zinc finger protein 655

Synonyms: VIK VIK-1
Gene ID:
Human(79027) Summary: This gene encodes a zinc finger protein. The zinc finger proteins are involved in DNA binding and protein-protein interactions. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
domestic cat(101087288) zinc finger protein 655
dog(489855) zinc finger protein 655
cow(506436) zinc finger protein 655
naked mole-rat(101730069) zinc finger protein 655
domestic guinea pig(101787362) zinc finger protein 655
226 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024061 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024061 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024061 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009956 Rosetta Predictions human pricing
NM_001009957 Rosetta Predictions human pricing
NM_001009958 Rosetta Predictions human pricing
NM_001009960 Rosetta Predictions human pricing
NM_001083956 Rosetta Predictions human pricing
NM_001085366 Rosetta Predictions human pricing
NM_001085367 Rosetta Predictions human pricing
NM_001085368 Rosetta Predictions human pricing
NM_024061 Rosetta Predictions human pricing
NM_138494 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180005 predicted 864
2 SASI_Hs01_00180006 predicted 888
3 SASI_Hs01_00180007 predicted 872
4 SASI_Hs01_00180008 predicted 1005
5 SASI_Hs01_00180009 predicted 845
6 SASI_Hs01_00180010 predicted 631
7 SASI_Hs01_00180011 predicted 934
8 SASI_Hs01_00180012 predicted 980
9 SASI_Hs01_00180013 predicted 811
10 SASI_Hs01_00180014 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245372 predicted 959
2 SASI_Hs01_00245373 predicted 918
3 SASI_Hs01_00245374 predicted 432
4 SASI_Hs01_00245375 predicted 428
5 SASI_Hs01_00245376 predicted 679
6 SASI_Hs01_00245377 predicted 833
7 SASI_Hs01_00245378 predicted 931
8 SASI_Hs01_00245379 predicted 836
9 SASI_Hs01_00245380 predicted 736
10 SASI_Hs01_00245381 predicted 1000
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009958 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122341 predicted 882
2 SASI_Hs01_00122342 predicted 617
3 SASI_Hs01_00122343 predicted 862
4 SASI_Hs01_00122344 predicted 661
5 SASI_Hs02_00305748 predicted 961
6 SASI_Hs02_00305749 predicted 610
7 SASI_Hs01_00122345 predicted 611
8 SASI_Hs01_00122346 predicted 949
9 SASI_Hs01_00122347 predicted 589
10 SASI_Hs02_00305750 predicted 578
11 SASI_Hs01_00122338 predicted 711
12 SASI_Hs01_00122339 predicted 763
13 SASI_Hs01_00122340 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009960 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238265 predicted 602
2 SASI_Hs01_00238266 predicted 1217
3 SASI_Hs01_00238267 predicted 1116
4 SASI_Hs01_00238268 predicted 1425
5 SASI_Hs01_00238269 predicted 1715
6 SASI_Hs01_00238270 predicted 571
7 SASI_Hs01_00238271 predicted 1612
8 SASI_Hs01_00238272 predicted 772
9 SASI_Hs01_00238273 predicted 461
10 SASI_Hs01_00238274 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317361 predicted 877
2 SASI_Hs02_00317362 predicted 1486
3 SASI_Hs02_00317363 predicted 1387
4 SASI_Hs02_00317364 predicted 1703
5 SASI_Hs02_00317365 predicted 1996
6 SASI_Hs02_00317366 predicted 849
7 SASI_Hs02_00317367 predicted 1881
8 SASI_Hs02_00317368 predicted 1050
9 SASI_Hs02_00317369 predicted 731
10 SASI_Hs02_00317370 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317486 predicted 1062
2 SASI_Hs02_00317487 predicted 782
3 SASI_Hs02_00317488 predicted 1033
4 SASI_Hs02_00317489 predicted 834
5 SASI_Hs02_00317490 predicted 1129
6 SASI_Hs02_00317491 predicted 785
7 SASI_Hs02_00317492 predicted 787
8 SASI_Hs02_00317493 predicted 1126
9 SASI_Hs02_00317494 predicted 763
10 SASI_Hs02_00317495 predicted 751
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317496 predicted 1096
2 SASI_Hs02_00317497 predicted 829
3 SASI_Hs02_00317498 predicted 1073
4 SASI_Hs02_00317499 predicted 875
5 SASI_Hs02_00317500 predicted 1169
6 SASI_Hs02_00317501 predicted 820
7 SASI_Hs02_00317502 predicted 824
8 SASI_Hs02_00317503 predicted 1160
9 SASI_Hs02_00317504 predicted 797
10 SASI_Hs02_00317505 predicted 796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085368 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317506 predicted 711
2 SASI_Hs02_00317507 predicted 1321
3 SASI_Hs02_00317508 predicted 1221
4 SASI_Hs02_00317509 predicted 1535
5 SASI_Hs02_00317510 predicted 1822
6 SASI_Hs02_00317511 predicted 681
7 SASI_Hs02_00317512 predicted 1717
8 SASI_Hs02_00317513 predicted 882
9 SASI_Hs02_00317514 predicted 563
10 SASI_Hs02_00317515 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024061 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192431 predicted 1270
2 SASI_Hs01_00192432 predicted 1002
3 SASI_Hs01_00192433 predicted 1242
4 SASI_Hs01_00192434 predicted 1048
5 SASI_Hs02_00356514 predicted 1344
6 SASI_Hs02_00356515 predicted 1002
7 SASI_Hs01_00192435 predicted 1004
8 SASI_Hs01_00192436 predicted 1334
9 SASI_Hs01_00192437 predicted 975
10 SASI_Hs02_00356516 predicted 969
11 SASI_Hs01_00192428 predicted 1097
12 SASI_Hs01_00192429 predicted 1142
13 SASI_Hs01_00192430 predicted 1347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138494 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167498 predicted 779
2 SASI_Hs01_00167499 predicted 1389
3 SASI_Hs01_00167500 predicted 1282
4 SASI_Hs01_00167501 predicted 1600
5 SASI_Hs01_00167502 predicted 1891
6 SASI_Hs01_00167503 predicted 745
7 SASI_Hs01_00167504 predicted 1782
8 SASI_Hs01_00167505 predicted 951
9 SASI_Hs02_00363686 predicted 630
10 SASI_Hs02_00363687 predicted 649
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024061
VALIDATED
ZNF655 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 655
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024061.2-593s1c1
Sequence:CCGGCCCGGATTCATAGTGTGAATTCTCGAGAATTCACACTATGAATCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024061.2-470s1c1
Sequence:CCGGTGCACCTTACTCGAGAGGAATCTCGAGATTCCTCTCGAGTAAGGTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024061.3-851s21c1
Sequence:CCGGCAGCAGGAATCTCCAAGAGATCTCGAGATCTCTTGGAGATTCCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024061.3-612s21c1
Sequence:CCGGCCAGGAGTTTGTGACATTCGACTCGAGTCGAATGTCACAAACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024061.3-644s21c1
Sequence:CCGGTGCACCTTACTCGAGAGGAATCTCGAGATTCCTCTCGAGTAAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024061.3-815s21c1
Sequence:CCGGCAAGTGCTTTCTCTGGAGAAACTCGAGTTTCTCCAGAGAAAGCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024061
VALIDATED
ZNF655 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 655
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024061.2-593s1c1
Sequence:CCGGCCCGGATTCATAGTGTGAATTCTCGAGAATTCACACTATGAATCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024061.2-470s1c1
Sequence:CCGGTGCACCTTACTCGAGAGGAATCTCGAGATTCCTCTCGAGTAAGGTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024061.3-851s21c1
Sequence:CCGGCAGCAGGAATCTCCAAGAGATCTCGAGATCTCTTGGAGATTCCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024061.3-612s21c1
Sequence:CCGGCCAGGAGTTTGTGACATTCGACTCGAGTCGAATGTCACAAACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024061.3-644s21c1
Sequence:CCGGTGCACCTTACTCGAGAGGAATCTCGAGATTCCTCTCGAGTAAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024061.3-815s21c1
Sequence:CCGGCAAGTGCTTTCTCTGGAGAAACTCGAGTTTCTCCAGAGAAAGCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024061
VALIDATED
ZNF655 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 655
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024061.2-593s1c1
Sequence:CCGGCCCGGATTCATAGTGTGAATTCTCGAGAATTCACACTATGAATCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024061.2-470s1c1
Sequence:CCGGTGCACCTTACTCGAGAGGAATCTCGAGATTCCTCTCGAGTAAGGTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024061.3-851s21c1
Sequence:CCGGCAGCAGGAATCTCCAAGAGATCTCGAGATCTCTTGGAGATTCCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024061.3-612s21c1
Sequence:CCGGCCAGGAGTTTGTGACATTCGACTCGAGTCGAATGTCACAAACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024061.3-644s21c1
Sequence:CCGGTGCACCTTACTCGAGAGGAATCTCGAGATTCCTCTCGAGTAAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024061.3-815s21c1
Sequence:CCGGCAAGTGCTTTCTCTGGAGAAACTCGAGTTTCTCCAGAGAAAGCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks