EMAIL THIS PAGE TO A FRIEND

ZNF658

zinc finger protein 658

UniProtKB ID: Q5TYW1, Q6PIP3, Q96M55, Q9H9S6, Q9UG02
Gene ID:
domestic cat(101091908) zinc finger protein 658
Horse(100069083) zinc finger protein 658
dog(491382) zinc finger protein 658
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033160 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033160 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033160 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111811 MISSION® esiRNA esiRNA human ZNF658 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033160 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065885 predicted 1383
2 SASI_Hs02_00360898 predicted 316
3 SASI_Hs01_00065888 predicted 2910
4 SASI_Hs01_00065889 predicted 1745
5 SASI_Hs02_00360899 predicted 2825
6 SASI_Hs02_00360900 predicted 3087
7 SASI_Hs01_00065891 predicted 522
8 SASI_Hs01_00065892 predicted 2986
9 SASI_Hs01_00065893 predicted 551
10 SASI_Hs01_00065894 predicted 1650
11 SASI_Hs01_00065886 predicted 587
12 SASI_Hs01_00065887 predicted 1401
13 SASI_Hs01_00065890 predicted 1466
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033160
ZNF658 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 658
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033160.5-3762s21c1
Sequence:CCGGTAGTTAAATGGACGTAGTTTACTCGAGTAAACTACGTCCATTTAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033160.5-3568s21c1
Sequence:CCGGTAAGATGGATTTGGAGGTTATCTCGAGATAACCTCCAAATCCATCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033160.3-432s1c1
Sequence:CCGGGCCCATATAGTACATCAGAAACTCGAGTTTCTGATGTACTATATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033160.3-1503s1c1
Sequence:CCGGGCCCATAATTCAGCCCTCAAACTCGAGTTTGAGGGCTGAATTATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033160.3-904s1c1
Sequence:CCGGGCAGTGAATATGGGAAGACATCTCGAGATGTCTTCCCATATTCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033160.3-2272s1c1
Sequence:CCGGCCCTCAGAGTACATCAAAGAACTCGAGTTCTTTGATGTACTCTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033160.3-262s1c1
Sequence:CCGGCCACCGCTGTTGAATACAATACTCGAGTATTGTATTCAACAGCGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033160
ZNF658 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 658
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033160.5-3762s21c1
Sequence:CCGGTAGTTAAATGGACGTAGTTTACTCGAGTAAACTACGTCCATTTAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033160.5-3568s21c1
Sequence:CCGGTAAGATGGATTTGGAGGTTATCTCGAGATAACCTCCAAATCCATCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033160.3-432s1c1
Sequence:CCGGGCCCATATAGTACATCAGAAACTCGAGTTTCTGATGTACTATATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033160.3-1503s1c1
Sequence:CCGGGCCCATAATTCAGCCCTCAAACTCGAGTTTGAGGGCTGAATTATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033160.3-904s1c1
Sequence:CCGGGCAGTGAATATGGGAAGACATCTCGAGATGTCTTCCCATATTCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033160.3-2272s1c1
Sequence:CCGGCCCTCAGAGTACATCAAAGAACTCGAGTTCTTTGATGTACTCTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033160.3-262s1c1
Sequence:CCGGCCACCGCTGTTGAATACAATACTCGAGTATTGTATTCAACAGCGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033160
ZNF658 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 658
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033160.5-3762s21c1
Sequence:CCGGTAGTTAAATGGACGTAGTTTACTCGAGTAAACTACGTCCATTTAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033160.5-3568s21c1
Sequence:CCGGTAAGATGGATTTGGAGGTTATCTCGAGATAACCTCCAAATCCATCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033160.3-432s1c1
Sequence:CCGGGCCCATATAGTACATCAGAAACTCGAGTTTCTGATGTACTATATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033160.3-1503s1c1
Sequence:CCGGGCCCATAATTCAGCCCTCAAACTCGAGTTTGAGGGCTGAATTATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033160.3-904s1c1
Sequence:CCGGGCAGTGAATATGGGAAGACATCTCGAGATGTCTTCCCATATTCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033160.3-2272s1c1
Sequence:CCGGCCCTCAGAGTACATCAAAGAACTCGAGTTCTTTGATGTACTCTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033160.3-262s1c1
Sequence:CCGGCCACCGCTGTTGAATACAATACTCGAGTATTGTATTCAACAGCGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks