EMAIL THIS PAGE TO A FRIEND

ZNF658B

zinc finger protein 658B, pseudogene

Species: Human ZNF658B(401509)
UniProtKB ID: Q4V348, Q8N946
Gene ID:
26 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001032297 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001032297 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001032297 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032297 Rosetta Predictions human pricing
XM_001713868 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032297 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171889 predicted 741
2 SASI_Hs01_00171892 predicted 2272
3 SASI_Hs01_00171893 predicted 1103
4 SASI_Hs02_00307892 predicted 1021
5 SASI_Hs02_00307893 predicted 2184
6 SASI_Hs01_00171895 predicted 644
7 SASI_Hs01_00171896 predicted 2445
8 SASI_Hs01_00171897 predicted 2347
9 SASI_Hs01_00171898 predicted 1014
10 SASI_Hs02_00307894 predicted 438
11 SASI_Hs01_00171890 predicted 634
12 SASI_Hs01_00171891 predicted 806
13 SASI_Hs01_00171894 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713868 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00393476 predicted 1049
2 SASI_Hs02_00393477 predicted 2578
3 SASI_Hs02_00393478 predicted 1403
4 SASI_Hs02_00393479 predicted 2489
5 SASI_Hs02_00393480 predicted 946
6 SASI_Hs02_00393481 predicted 2753
7 SASI_Hs02_00393482 predicted 2648
8 SASI_Hs02_00393483 predicted 207
9 SASI_Hs02_00393484 predicted 1318
10 SASI_Hs02_00393485 predicted 745
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001032297
ZNF658B MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 658B, pseudogene
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001032297.1-2870s1c1
Sequence:CCGGCATTTACTCTTGGCCCTTAAACTCGAGTTTAAGGGCCAAGAGTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032297.1-2495s1c1
Sequence:CCGGGAGTGTAATGAATGCGGGAAACTCGAGTTTCCCGCATTCATTACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032297.1-1695s1c1
Sequence:CCGGCCCTTAGAGCACATCAGAATACTCGAGTATTCTGATGTGCTCTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032297.1-1947s1c1
Sequence:CCGGCCCTCATAGTGCATCAAAGAACTCGAGTTCTTTGATGCACTATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032297.1-2579s1c1
Sequence:CCGGGAATGTGATGAATGTGGGAAACTCGAGTTTCCCACATTCATCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001032297.1-3162s1c1
Sequence:CCGGGTGAGATGAAACCCTATGAATCTCGAGATTCATAGGGTTTCATCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032297.1-2075s1c1
Sequence:CCGGGAGTGTAATGAATGTGGGAAACTCGAGTTTCCCACATTCATTACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032297.1-1470s1c1
Sequence:CCGGCAAGGGAGAAACCCTATGAATCTCGAGATTCATAGGGTTTCTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032297.1-630s1c1
Sequence:CCGGACTTTACAGCACATCAGAAATCTCGAGATTTCTGATGTGCTGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219858    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001032297.1-2844s1c1
Sequence:CCGGGGATATGGTGCTAATGATATACTCGAGTATATCATTAGCACCATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001032297
ZNF658B MISSION shRNA shRNA Plasmid DNA
zinc finger protein 658B, pseudogene
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001032297.1-2870s1c1
Sequence:CCGGCATTTACTCTTGGCCCTTAAACTCGAGTTTAAGGGCCAAGAGTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032297.1-2495s1c1
Sequence:CCGGGAGTGTAATGAATGCGGGAAACTCGAGTTTCCCGCATTCATTACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032297.1-1695s1c1
Sequence:CCGGCCCTTAGAGCACATCAGAATACTCGAGTATTCTGATGTGCTCTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032297.1-1947s1c1
Sequence:CCGGCCCTCATAGTGCATCAAAGAACTCGAGTTCTTTGATGCACTATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032297.1-2579s1c1
Sequence:CCGGGAATGTGATGAATGTGGGAAACTCGAGTTTCCCACATTCATCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001032297.1-3162s1c1
Sequence:CCGGGTGAGATGAAACCCTATGAATCTCGAGATTCATAGGGTTTCATCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032297.1-2075s1c1
Sequence:CCGGGAGTGTAATGAATGTGGGAAACTCGAGTTTCCCACATTCATTACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032297.1-1470s1c1
Sequence:CCGGCAAGGGAGAAACCCTATGAATCTCGAGATTCATAGGGTTTCTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032297.1-630s1c1
Sequence:CCGGACTTTACAGCACATCAGAAATCTCGAGATTTCTGATGTGCTGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219858    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001032297.1-2844s1c1
Sequence:CCGGGGATATGGTGCTAATGATATACTCGAGTATATCATTAGCACCATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001032297
ZNF658B MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 658B, pseudogene
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001032297.1-2870s1c1
Sequence:CCGGCATTTACTCTTGGCCCTTAAACTCGAGTTTAAGGGCCAAGAGTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032297.1-2495s1c1
Sequence:CCGGGAGTGTAATGAATGCGGGAAACTCGAGTTTCCCGCATTCATTACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032297.1-1695s1c1
Sequence:CCGGCCCTTAGAGCACATCAGAATACTCGAGTATTCTGATGTGCTCTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032297.1-1947s1c1
Sequence:CCGGCCCTCATAGTGCATCAAAGAACTCGAGTTCTTTGATGCACTATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032297.1-2579s1c1
Sequence:CCGGGAATGTGATGAATGTGGGAAACTCGAGTTTCCCACATTCATCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001032297.1-3162s1c1
Sequence:CCGGGTGAGATGAAACCCTATGAATCTCGAGATTCATAGGGTTTCATCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032297.1-2075s1c1
Sequence:CCGGGAGTGTAATGAATGTGGGAAACTCGAGTTTCCCACATTCATTACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032297.1-1470s1c1
Sequence:CCGGCAAGGGAGAAACCCTATGAATCTCGAGATTCATAGGGTTTCTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032297.1-630s1c1
Sequence:CCGGACTTTACAGCACATCAGAAATCTCGAGATTTCTGATGTGCTGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219858    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001032297.1-2844s1c1
Sequence:CCGGGGATATGGTGCTAATGATATACTCGAGTATATCATTAGCACCATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks