EMAIL THIS PAGE TO A FRIEND

ZNF660

zinc finger protein 660

UniProtKB ID: Q6AZW8, Q7Z331, Q8N9M8
Gene ID:
dog(491422) zinc finger protein 660
domestic cat(101100150) zinc finger protein 660
domestic guinea pig(101787216) zinc finger protein 660
naked mole-rat(101706515) zinc finger protein 660
sheep(101120783) zinc finger protein 660
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173658 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173658 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173658 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003421 MISSION® esiRNA esiRNA targeting human ZNF660 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173658 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092727 predicted 832
2 SASI_Hs01_00092728 predicted 338
3 SASI_Hs01_00092730 predicted 584
4 SASI_Hs01_00092731 predicted 508
5 SASI_Hs01_00092732 predicted 594
6 SASI_Hs01_00092733 predicted 527
7 SASI_Hs01_00092734 predicted 587
8 SASI_Hs01_00092735 predicted 361
9 SASI_Hs01_00092736 predicted 588
10 SASI_Hs02_00368573 predicted 338
11 SASI_Hs01_00092729 predicted 606
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173658
ZNF660 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 660
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173658.1-1267s1c1
Sequence:CCGGCGGTATAGTTCACAGCTTATTCTCGAGAATAAGCTGTGAACTATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173658.1-442s1c1
Sequence:CCGGCCTGCAACAAATGAGAGAGTTCTCGAGAACTCTCTCATTTGTTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173658.1-773s1c1
Sequence:CCGGCGGGCCTTATATCACATCACACTCGAGTGTGATGTGATATAAGGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173658.1-1282s1c1
Sequence:CCGGCTTATTCAACACCAGAGGAAACTCGAGTTTCCTCTGGTGTTGAATAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173658.1-678s1c1
Sequence:CCGGCAGTGGAAAGTCACATCTTATCTCGAGATAAGATGTGACTTTCCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173658
ZNF660 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 660
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173658.1-1267s1c1
Sequence:CCGGCGGTATAGTTCACAGCTTATTCTCGAGAATAAGCTGTGAACTATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173658.1-442s1c1
Sequence:CCGGCCTGCAACAAATGAGAGAGTTCTCGAGAACTCTCTCATTTGTTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173658.1-773s1c1
Sequence:CCGGCGGGCCTTATATCACATCACACTCGAGTGTGATGTGATATAAGGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173658.1-1282s1c1
Sequence:CCGGCTTATTCAACACCAGAGGAAACTCGAGTTTCCTCTGGTGTTGAATAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173658.1-678s1c1
Sequence:CCGGCAGTGGAAAGTCACATCTTATCTCGAGATAAGATGTGACTTTCCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173658
ZNF660 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 660
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173658.1-1267s1c1
Sequence:CCGGCGGTATAGTTCACAGCTTATTCTCGAGAATAAGCTGTGAACTATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173658.1-442s1c1
Sequence:CCGGCCTGCAACAAATGAGAGAGTTCTCGAGAACTCTCTCATTTGTTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173658.1-773s1c1
Sequence:CCGGCGGGCCTTATATCACATCACACTCGAGTGTGATGTGATATAAGGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173658.1-1282s1c1
Sequence:CCGGCTTATTCAACACCAGAGGAAACTCGAGTTTCCTCTGGTGTTGAATAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173658.1-678s1c1
Sequence:CCGGCAGTGGAAAGTCACATCTTATCTCGAGATAAGATGTGACTTTCCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks