EMAIL THIS PAGE TO A FRIEND

ZNF662

zinc finger protein 662

UniProtKB ID: Q6ZS27, Q6ZNF8, Q6ZQW8
Gene ID:
sheep(101120115) zinc finger protein 662
chicken(771614) zinc finger protein 662
domestic cat(101094203) zinc finger protein 662
Horse(100067093) zinc finger protein 662
dog(485620) zinc finger protein 662
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_371631 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371631 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371631 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207404 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049575 predicted 1003
2 SASI_Hs01_00049577 predicted 858
3 SASI_Hs01_00049578 predicted 1050
4 SASI_Hs01_00049579 predicted 711
5 SASI_Hs01_00049580 predicted 875
6 SASI_Hs01_00049581 predicted 870
7 SASI_Hs02_00374013 predicted 842
8 SASI_Hs02_00374014 predicted 1049
9 SASI_Hs02_00374015 predicted 1096
10 SASI_Hs02_00374016 predicted 1201
11 SASI_Hs01_00049574 predicted 1118
12 SASI_Hs01_00049576 predicted 910
13 SASI_Hs01_00049582 predicted 790
14 SASI_Hs01_00049583 predicted 499
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371631
ZNF662 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 662
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371631.1-1540s1c1
Sequence:CCGGCTTCAGTCAGAATTCTGTCTTCTCGAGAAGACAGAATTCTGACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371631.1-860s1c1
Sequence:CCGGTCAGGGAATACTGATGTCAATCTCGAGATTGACATCAGTATTCCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371631.1-1738s1c1
Sequence:CCGGGCCAGTATTATCTTGCCCTTTCTCGAGAAAGGGCAAGATAATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371631.1-1469s1c1
Sequence:CCGGGCACATCTTATTCGACATCAACTCGAGTTGATGTCGAATAAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371631.1-712s1c1
Sequence:CCGGCCAGGAATTATGGTTTGGGAACTCGAGTTCCCAAACCATAATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371631
ZNF662 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 662
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371631.1-1540s1c1
Sequence:CCGGCTTCAGTCAGAATTCTGTCTTCTCGAGAAGACAGAATTCTGACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371631.1-860s1c1
Sequence:CCGGTCAGGGAATACTGATGTCAATCTCGAGATTGACATCAGTATTCCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371631.1-1738s1c1
Sequence:CCGGGCCAGTATTATCTTGCCCTTTCTCGAGAAAGGGCAAGATAATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371631.1-1469s1c1
Sequence:CCGGGCACATCTTATTCGACATCAACTCGAGTTGATGTCGAATAAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371631.1-712s1c1
Sequence:CCGGCCAGGAATTATGGTTTGGGAACTCGAGTTCCCAAACCATAATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371631
ZNF662 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 662
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371631.1-1540s1c1
Sequence:CCGGCTTCAGTCAGAATTCTGTCTTCTCGAGAAGACAGAATTCTGACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371631.1-860s1c1
Sequence:CCGGTCAGGGAATACTGATGTCAATCTCGAGATTGACATCAGTATTCCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371631.1-1738s1c1
Sequence:CCGGGCCAGTATTATCTTGCCCTTTCTCGAGAAAGGGCAAGATAATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371631.1-1469s1c1
Sequence:CCGGGCACATCTTATTCGACATCAACTCGAGTTGATGTCGAATAAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371631.1-712s1c1
Sequence:CCGGCCAGGAATTATGGTTTGGGAACTCGAGTTCCCAAACCATAATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks