EMAIL THIS PAGE TO A FRIEND

ZNF664

zinc finger protein 664

Synonyms: ZFOC1 ZNF176
UniProtKB ID: Q8N3J9, B3KP97, Q15914, Q3ZCQ7
Gene ID:
domestic cat(101099907) zinc finger protein 664
dog(100687539) zinc finger protein 664
cow(540318) zinc finger protein 664
sheep(101116174) zinc finger protein 664
100 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152437 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152437 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152437 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152437 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108866 predicted 1945
2 SASI_Hs01_00108867 predicted 1928
3 SASI_Hs01_00108868 predicted 1927
4 SASI_Hs01_00108869 predicted 2167
5 SASI_Hs01_00108870 predicted 2687
6 SASI_Hs01_00108871 predicted 2641
7 SASI_Hs01_00108872 predicted 2108
8 SASI_Hs01_00108873 predicted 2656
9 SASI_Hs01_00108874 predicted 2009
10 SASI_Hs01_00108875 predicted 1994
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152437
VALIDATED
ZNF664 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 664
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107275    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152437.1-2879s1c1
Sequence:CCGGGCCTCCATAGTTGAAAGACTACTCGAGTAGTCTTTCAACTATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152437.1-2570s1c1
Sequence:CCGGGAGTCCACACAAAGGAGAGAACTCGAGTTCTCTCCTTTGTGTGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152437.1-1928s1c1
Sequence:CCGGGTGACAAGTGTGATAAGGGTTCTCGAGAACCCTTATCACACTTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152437.1-1969s1c1
Sequence:CCGGCATATTCATTGGAGAGACCATCTCGAGATGGTCTCTCCAATGAATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152437.1-2127s1c1
Sequence:CCGGCTCCCATCTTCAAATTCATATCTCGAGATATGAATTTGAAGATGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152437.1-2216s21c1
Sequence:CCGGACCTTTGCATGCATCAGAGAGCTCGAGCTCTCTGATGCATGCAAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152437.1-2714s21c1
Sequence:CCGGTCCCTAGCAGAACATTGTTTCCTCGAGGAAACAATGTTCTGCTAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152437.1-1950s21c1
Sequence:CCGGCTTTCATATATCAGAACTTCACTCGAGTGAAGTTCTGATATATGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152437.1-3057s21c1
Sequence:CCGGTAAGATCACGTTCTGGTATTTCTCGAGAAATACCAGAACGTGATCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152437.1-2001s21c1
Sequence:CCGGGGTCTATAAATGTGATGATTGCTCGAGCAATCATCACATTTATAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152437.1-2299s21c1
Sequence:CCGGAGCCTCTGCATGCATCAAAGACTCGAGTCTTTGATGCATGCAGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152437
VALIDATED
ZNF664 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 664
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107275    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152437.1-2879s1c1
Sequence:CCGGGCCTCCATAGTTGAAAGACTACTCGAGTAGTCTTTCAACTATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152437.1-2570s1c1
Sequence:CCGGGAGTCCACACAAAGGAGAGAACTCGAGTTCTCTCCTTTGTGTGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152437.1-1928s1c1
Sequence:CCGGGTGACAAGTGTGATAAGGGTTCTCGAGAACCCTTATCACACTTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152437.1-1969s1c1
Sequence:CCGGCATATTCATTGGAGAGACCATCTCGAGATGGTCTCTCCAATGAATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152437.1-2127s1c1
Sequence:CCGGCTCCCATCTTCAAATTCATATCTCGAGATATGAATTTGAAGATGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152437.1-2216s21c1
Sequence:CCGGACCTTTGCATGCATCAGAGAGCTCGAGCTCTCTGATGCATGCAAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152437.1-2714s21c1
Sequence:CCGGTCCCTAGCAGAACATTGTTTCCTCGAGGAAACAATGTTCTGCTAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152437.1-1950s21c1
Sequence:CCGGCTTTCATATATCAGAACTTCACTCGAGTGAAGTTCTGATATATGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152437.1-3057s21c1
Sequence:CCGGTAAGATCACGTTCTGGTATTTCTCGAGAAATACCAGAACGTGATCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152437.1-2001s21c1
Sequence:CCGGGGTCTATAAATGTGATGATTGCTCGAGCAATCATCACATTTATAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152437.1-2299s21c1
Sequence:CCGGAGCCTCTGCATGCATCAAAGACTCGAGTCTTTGATGCATGCAGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152437
VALIDATED
ZNF664 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 664
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107275    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152437.1-2879s1c1
Sequence:CCGGGCCTCCATAGTTGAAAGACTACTCGAGTAGTCTTTCAACTATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152437.1-2570s1c1
Sequence:CCGGGAGTCCACACAAAGGAGAGAACTCGAGTTCTCTCCTTTGTGTGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152437.1-1928s1c1
Sequence:CCGGGTGACAAGTGTGATAAGGGTTCTCGAGAACCCTTATCACACTTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152437.1-1969s1c1
Sequence:CCGGCATATTCATTGGAGAGACCATCTCGAGATGGTCTCTCCAATGAATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152437.1-2127s1c1
Sequence:CCGGCTCCCATCTTCAAATTCATATCTCGAGATATGAATTTGAAGATGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152437.1-2216s21c1
Sequence:CCGGACCTTTGCATGCATCAGAGAGCTCGAGCTCTCTGATGCATGCAAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152437.1-2714s21c1
Sequence:CCGGTCCCTAGCAGAACATTGTTTCCTCGAGGAAACAATGTTCTGCTAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152437.1-1950s21c1
Sequence:CCGGCTTTCATATATCAGAACTTCACTCGAGTGAAGTTCTGATATATGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152437.1-3057s21c1
Sequence:CCGGTAAGATCACGTTCTGGTATTTCTCGAGAAATACCAGAACGTGATCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152437.1-2001s21c1
Sequence:CCGGGGTCTATAAATGTGATGATTGCTCGAGCAATCATCACATTTATAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152437.1-2299s21c1
Sequence:CCGGAGCCTCTGCATGCATCAAAGACTCGAGTCTTTGATGCATGCAGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks