EMAIL THIS PAGE TO A FRIEND

ZNF665

zinc finger protein 665

Synonyms: ZFP160L
UniProtKB ID: Q9H7R5, A8K5T8
Gene ID:
Horse(100063483) zinc finger protein 665
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024733 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024733 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024733 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132891 MISSION® esiRNA esiRNA human ZNF665 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024733 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024733 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114696 predicted 823
2 SASI_Hs01_00114697 predicted 529
3 SASI_Hs01_00114698 predicted 1267
4 SASI_Hs01_00114699 predicted 1177
5 SASI_Hs01_00114701 predicted 1751
6 SASI_Hs01_00114702 predicted 1345
7 SASI_Hs01_00114703 predicted 757
8 SASI_Hs01_00114704 predicted 668
9 SASI_Hs02_00357207 predicted 1930
10 SASI_Hs01_00114705 predicted 1823
11 SASI_Hs01_00114700 predicted 1666
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024733
ZNF665 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 665
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024733.3-670s21c1
Sequence:CCGGCTCACGGCTAACAAGTCATAACTCGAGTTATGACTTGTTAGCCGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024733.3-1253s21c1
Sequence:CCGGATGCATTCAAACTTAACTAAGCTCGAGCTTAGTTAAGTTTGAATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024733.3-598s21c1
Sequence:CCGGAGTTGAGAAGTCTCCTAATAACTCGAGTTATTAGGAGACTTCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024733.3-1673s21c1
Sequence:CCGGGTTCATTCAAGCCTAACTATACTCGAGTATAGTTAGGCTTGAATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024733.3-2701s21c1
Sequence:CCGGCATGCATGCTGAGACTATTACCTCGAGGTAATAGTCTCAGCATGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024733.2-2869s1c1
Sequence:CCGGGCCAATTACTTTCAGCTTATACTCGAGTATAAGCTGAAAGTAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024733.2-821s1c1
Sequence:CCGGCCTTCAAACCTTGCAGGTCATCTCGAGATGACCTGCAAGGTTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024733.2-1322s1c1
Sequence:CCGGCAGTATTCACACTTAGCAAATCTCGAGATTTGCTAAGTGTGAATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024733.2-1682s1c1
Sequence:CCGGCAGACAATACATACTGGACAACTCGAGTTGTCCAGTATGTATTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024733.2-592s1c1
Sequence:CCGGGTCTCCTAATAATCGAGGAAACTCGAGTTTCCTCGATTATTAGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024733
ZNF665 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 665
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024733.3-670s21c1
Sequence:CCGGCTCACGGCTAACAAGTCATAACTCGAGTTATGACTTGTTAGCCGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024733.3-1253s21c1
Sequence:CCGGATGCATTCAAACTTAACTAAGCTCGAGCTTAGTTAAGTTTGAATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024733.3-598s21c1
Sequence:CCGGAGTTGAGAAGTCTCCTAATAACTCGAGTTATTAGGAGACTTCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024733.3-1673s21c1
Sequence:CCGGGTTCATTCAAGCCTAACTATACTCGAGTATAGTTAGGCTTGAATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024733.3-2701s21c1
Sequence:CCGGCATGCATGCTGAGACTATTACCTCGAGGTAATAGTCTCAGCATGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024733.2-2869s1c1
Sequence:CCGGGCCAATTACTTTCAGCTTATACTCGAGTATAAGCTGAAAGTAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024733.2-821s1c1
Sequence:CCGGCCTTCAAACCTTGCAGGTCATCTCGAGATGACCTGCAAGGTTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024733.2-1322s1c1
Sequence:CCGGCAGTATTCACACTTAGCAAATCTCGAGATTTGCTAAGTGTGAATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024733.2-1682s1c1
Sequence:CCGGCAGACAATACATACTGGACAACTCGAGTTGTCCAGTATGTATTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024733.2-592s1c1
Sequence:CCGGGTCTCCTAATAATCGAGGAAACTCGAGTTTCCTCGATTATTAGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024733
ZNF665 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 665
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024733.3-670s21c1
Sequence:CCGGCTCACGGCTAACAAGTCATAACTCGAGTTATGACTTGTTAGCCGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024733.3-1253s21c1
Sequence:CCGGATGCATTCAAACTTAACTAAGCTCGAGCTTAGTTAAGTTTGAATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024733.3-598s21c1
Sequence:CCGGAGTTGAGAAGTCTCCTAATAACTCGAGTTATTAGGAGACTTCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024733.3-1673s21c1
Sequence:CCGGGTTCATTCAAGCCTAACTATACTCGAGTATAGTTAGGCTTGAATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024733.3-2701s21c1
Sequence:CCGGCATGCATGCTGAGACTATTACCTCGAGGTAATAGTCTCAGCATGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024733.2-2869s1c1
Sequence:CCGGGCCAATTACTTTCAGCTTATACTCGAGTATAAGCTGAAAGTAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024733.2-821s1c1
Sequence:CCGGCCTTCAAACCTTGCAGGTCATCTCGAGATGACCTGCAAGGTTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024733.2-1322s1c1
Sequence:CCGGCAGTATTCACACTTAGCAAATCTCGAGATTTGCTAAGTGTGAATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024733.2-1682s1c1
Sequence:CCGGCAGACAATACATACTGGACAACTCGAGTTGTCCAGTATGTATTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024733.2-592s1c1
Sequence:CCGGGTCTCCTAATAATCGAGGAAACTCGAGTTTCCTCGATTATTAGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks