EMAIL THIS PAGE TO A FRIEND

ZNF667

zinc finger protein 667

Synonyms: MIPU1
UniProtKB ID: Q5HYK9, B2RMS6, B9EK36, Q6B093, Q9H807
Gene ID:
dog(100687632) zinc finger protein 667
Horse(100057599) zinc finger protein 667
domestic cat(101096368) zinc finger protein 667
cow(523322) zinc finger protein 667
sheep(101105941) zinc finger protein 667
naked mole-rat(101720538) zinc finger protein 667
domestic guinea pig(100734580) zinc finger protein 667
32 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022103 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022103 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022103 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022103 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149025 predicted 522
2 SASI_Hs01_00149026 predicted 1603
3 SASI_Hs01_00149027 predicted 260
4 SASI_Hs02_00355491 predicted 1926
5 SASI_Hs01_00149028 predicted 1946
6 SASI_Hs01_00149030 predicted 483
7 SASI_Hs02_00355492 predicted 1235
8 SASI_Hs01_00149031 predicted 1110
9 SASI_Hs01_00149032 predicted 1270
10 SASI_Hs01_00149033 predicted 1762
11 SASI_Hs01_00149029 predicted 871
12 SASI_Hs01_00149034 predicted 1101
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022103
ZNF667 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 667
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022103.2-1522s1c1
Sequence:CCGGCGCCAATCATTTCTTATTGAACTCGAGTTCAATAAGAAATGATTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022103.2-1609s1c1
Sequence:CCGGCGAATATCTCTCACACGACATCTCGAGATGTCGTGTGAGAGATATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022103.2-1274s1c1
Sequence:CCGGCAACCCTTATTCTGCATCTAACTCGAGTTAGATGCAGAATAAGGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022103.2-448s1c1
Sequence:CCGGCCTCCAAATCAATGCAACAAACTCGAGTTTGTTGCATTGATTTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022103.2-259s1c1
Sequence:CCGGCCCATTCAGAAGGATTTGTATCTCGAGATACAAATCCTTCTGAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022103.3-2045s21c1
Sequence:CCGGCAACGAATGAGGCTATCAAACCTCGAGGTTTGATAGCCTCATTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022103.3-650s21c1
Sequence:CCGGGTCGAAGCTTCTCTCTTAAACCTCGAGGTTTAAGAGAGAAGCTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022103
ZNF667 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 667
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022103.2-1522s1c1
Sequence:CCGGCGCCAATCATTTCTTATTGAACTCGAGTTCAATAAGAAATGATTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022103.2-1609s1c1
Sequence:CCGGCGAATATCTCTCACACGACATCTCGAGATGTCGTGTGAGAGATATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022103.2-1274s1c1
Sequence:CCGGCAACCCTTATTCTGCATCTAACTCGAGTTAGATGCAGAATAAGGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022103.2-448s1c1
Sequence:CCGGCCTCCAAATCAATGCAACAAACTCGAGTTTGTTGCATTGATTTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022103.2-259s1c1
Sequence:CCGGCCCATTCAGAAGGATTTGTATCTCGAGATACAAATCCTTCTGAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022103.3-2045s21c1
Sequence:CCGGCAACGAATGAGGCTATCAAACCTCGAGGTTTGATAGCCTCATTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022103.3-650s21c1
Sequence:CCGGGTCGAAGCTTCTCTCTTAAACCTCGAGGTTTAAGAGAGAAGCTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022103
ZNF667 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 667
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022103.2-1522s1c1
Sequence:CCGGCGCCAATCATTTCTTATTGAACTCGAGTTCAATAAGAAATGATTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022103.2-1609s1c1
Sequence:CCGGCGAATATCTCTCACACGACATCTCGAGATGTCGTGTGAGAGATATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022103.2-1274s1c1
Sequence:CCGGCAACCCTTATTCTGCATCTAACTCGAGTTAGATGCAGAATAAGGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022103.2-448s1c1
Sequence:CCGGCCTCCAAATCAATGCAACAAACTCGAGTTTGTTGCATTGATTTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022103.2-259s1c1
Sequence:CCGGCCCATTCAGAAGGATTTGTATCTCGAGATACAAATCCTTCTGAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022103.3-2045s21c1
Sequence:CCGGCAACGAATGAGGCTATCAAACCTCGAGGTTTGATAGCCTCATTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022103.3-650s21c1
Sequence:CCGGGTCGAAGCTTCTCTCTTAAACCTCGAGGTTTAAGAGAGAAGCTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks