EMAIL THIS PAGE TO A FRIEND

ZNF668

zinc finger protein 668

UniProtKB ID: Q96K58, Q59EV1, Q8N669, Q9H8L4
Gene ID:
Zebrafish(797423) zinc finger protein 668
Horse(100063426) zinc finger protein 668
domestic cat(101090314) zinc finger protein 668
dog(489920) zinc finger protein 668
domestic guinea pig(100732615) zinc finger protein 668
naked mole-rat(101711458) zinc finger protein 668
cow(767831) zinc finger protein 668
sheep(101103777) zinc finger protein 668
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024706 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024706 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024706 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024706 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139719 predicted 1326
2 SASI_Hs01_00139720 predicted 1229
3 SASI_Hs01_00139721 predicted 1128
4 SASI_Hs01_00139722 predicted 1980
5 SASI_Hs01_00139723 predicted 759
6 SASI_Hs01_00139724 predicted 2295
7 SASI_Hs01_00139725 predicted 1070
8 SASI_Hs01_00139726 predicted 1129
9 SASI_Hs01_00139727 predicted 1939
10 SASI_Hs01_00139728 predicted 2097
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024706
ZNF668 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 668
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024706.3-2374s21c1
Sequence:CCGGTTTGCTAGGAATGCCTGAAGACTCGAGTCTTCAGGCATTCCTAGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024706.3-2300s21c1
Sequence:CCGGAGCGACTTGCGCAAGCATGAACTCGAGTTCATGCTTGCGCAAGTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024706.3-1464s21c1
Sequence:CCGGAGCCATACCACTGCGAGAAGTCTCGAGACTTCTCGCAGTGGTATGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024706.3-2475s21c1
Sequence:CCGGTTGCCTGGCTCTGCTCTTTAGCTCGAGCTAAAGAGCAGAGCCAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024706.3-625s1c1
Sequence:CCGGCTGTACCAAGACATTTCCAAACTCGAGTTTGGAAATGTCTTGGTACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024706.3-1564s1c1
Sequence:CCGGGCAATGTGACAAGACGTTCGTCTCGAGACGAACGTCTTGTCACATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024706.3-1991s1c1
Sequence:CCGGGAGCATGTGGAATGCCAAGATCTCGAGATCTTGGCATTCCACATGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024706.3-1068s1c1
Sequence:CCGGGCAAGAGCTTTGCTGACCCTTCTCGAGAAGGGTCAGCAAAGCTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024706.3-2088s1c1
Sequence:CCGGCCCAGTTTGTGTGCCGAGAGTCTCGAGACTCTCGGCACACAAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024706
ZNF668 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 668
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024706.3-2374s21c1
Sequence:CCGGTTTGCTAGGAATGCCTGAAGACTCGAGTCTTCAGGCATTCCTAGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024706.3-2300s21c1
Sequence:CCGGAGCGACTTGCGCAAGCATGAACTCGAGTTCATGCTTGCGCAAGTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024706.3-1464s21c1
Sequence:CCGGAGCCATACCACTGCGAGAAGTCTCGAGACTTCTCGCAGTGGTATGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024706.3-2475s21c1
Sequence:CCGGTTGCCTGGCTCTGCTCTTTAGCTCGAGCTAAAGAGCAGAGCCAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024706.3-625s1c1
Sequence:CCGGCTGTACCAAGACATTTCCAAACTCGAGTTTGGAAATGTCTTGGTACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024706.3-1564s1c1
Sequence:CCGGGCAATGTGACAAGACGTTCGTCTCGAGACGAACGTCTTGTCACATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024706.3-1991s1c1
Sequence:CCGGGAGCATGTGGAATGCCAAGATCTCGAGATCTTGGCATTCCACATGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024706.3-1068s1c1
Sequence:CCGGGCAAGAGCTTTGCTGACCCTTCTCGAGAAGGGTCAGCAAAGCTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024706.3-2088s1c1
Sequence:CCGGCCCAGTTTGTGTGCCGAGAGTCTCGAGACTCTCGGCACACAAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024706
ZNF668 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 668
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024706.3-2374s21c1
Sequence:CCGGTTTGCTAGGAATGCCTGAAGACTCGAGTCTTCAGGCATTCCTAGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024706.3-2300s21c1
Sequence:CCGGAGCGACTTGCGCAAGCATGAACTCGAGTTCATGCTTGCGCAAGTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024706.3-1464s21c1
Sequence:CCGGAGCCATACCACTGCGAGAAGTCTCGAGACTTCTCGCAGTGGTATGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024706.3-2475s21c1
Sequence:CCGGTTGCCTGGCTCTGCTCTTTAGCTCGAGCTAAAGAGCAGAGCCAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024706.3-625s1c1
Sequence:CCGGCTGTACCAAGACATTTCCAAACTCGAGTTTGGAAATGTCTTGGTACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024706.3-1564s1c1
Sequence:CCGGGCAATGTGACAAGACGTTCGTCTCGAGACGAACGTCTTGTCACATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024706.3-1991s1c1
Sequence:CCGGGAGCATGTGGAATGCCAAGATCTCGAGATCTTGGCATTCCACATGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024706.3-1068s1c1
Sequence:CCGGGCAAGAGCTTTGCTGACCCTTCTCGAGAAGGGTCAGCAAAGCTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024706.3-2088s1c1
Sequence:CCGGCCCAGTTTGTGTGCCGAGAGTCTCGAGACTCTCGGCACACAAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks