EMAIL THIS PAGE TO A FRIEND

ZNF669

zinc finger protein 669

Species: Human ZNF669(79862)
UniProtKB ID: Q96BR6, B3KP94, Q5VT39, Q9H9Q6
Gene ID:
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024804 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024804 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024804 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135651 MISSION® esiRNA esiRNA human ZNF669 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024804 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024804 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179749 predicted 772
2 SASI_Hs01_00179750 predicted 853
3 SASI_Hs01_00179751 predicted 973
4 SASI_Hs01_00179752 predicted 787
5 SASI_Hs01_00179754 predicted 983
6 SASI_Hs01_00179755 predicted 584
7 SASI_Hs01_00179756 predicted 907
8 SASI_Hs01_00179757 predicted 817
9 SASI_Hs02_00357347 predicted 764
10 SASI_Hs02_00357348 predicted 795
11 SASI_Hs01_00179748 predicted 662
12 SASI_Hs01_00179753 predicted 859
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024804
ZNF669 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 669
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024804.1-664s1c1
Sequence:CCGGCGAGAACATTTCTACTGGATTCTCGAGAATCCAGTAGAAATGTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024804.1-1430s1c1
Sequence:CCGGCGCCATGAAAGAAGTCATGATCTCGAGATCATGACTTCTTTCATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024804.1-751s1c1
Sequence:CCGGCCTAGCTCACTCAGGATACAACTCGAGTTGTATCCTGAGTGAGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024804.1-1251s1c1
Sequence:CCGGGTTCCCTTTGTAACCATAGAACTCGAGTTCTATGGTTACAAAGGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024804.1-753s21c1
Sequence:CCGGTAGCTCACTCAGGATACAAACCTCGAGGTTTGTATCCTGAGTGAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024804.1-1463s21c1
Sequence:CCGGTGTAGTGACTCAGCCTATAATCTCGAGATTATAGGCTGAGTCACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024804.1-858s21c1
Sequence:GTACCGGACAGTGGAAATCCAGCTTATACTCGAGTATAAGCTGGATTTCCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024804.1-1559s21c1
Sequence:CCGGGTGAAACAACCTGGGCAACATCTCGAGATGTTGCCCAGGTTGTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024804.1-1261s21c1
Sequence:CCGGTAACCATAGAAGTACTCATACCTCGAGGTATGAGTACTTCTATGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024804
ZNF669 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 669
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024804.1-664s1c1
Sequence:CCGGCGAGAACATTTCTACTGGATTCTCGAGAATCCAGTAGAAATGTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024804.1-1430s1c1
Sequence:CCGGCGCCATGAAAGAAGTCATGATCTCGAGATCATGACTTCTTTCATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024804.1-751s1c1
Sequence:CCGGCCTAGCTCACTCAGGATACAACTCGAGTTGTATCCTGAGTGAGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024804.1-1251s1c1
Sequence:CCGGGTTCCCTTTGTAACCATAGAACTCGAGTTCTATGGTTACAAAGGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024804.1-753s21c1
Sequence:CCGGTAGCTCACTCAGGATACAAACCTCGAGGTTTGTATCCTGAGTGAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024804.1-1463s21c1
Sequence:CCGGTGTAGTGACTCAGCCTATAATCTCGAGATTATAGGCTGAGTCACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024804.1-858s21c1
Sequence:GTACCGGACAGTGGAAATCCAGCTTATACTCGAGTATAAGCTGGATTTCCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024804.1-1559s21c1
Sequence:CCGGGTGAAACAACCTGGGCAACATCTCGAGATGTTGCCCAGGTTGTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024804.1-1261s21c1
Sequence:CCGGTAACCATAGAAGTACTCATACCTCGAGGTATGAGTACTTCTATGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024804
ZNF669 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 669
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024804.1-664s1c1
Sequence:CCGGCGAGAACATTTCTACTGGATTCTCGAGAATCCAGTAGAAATGTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024804.1-1430s1c1
Sequence:CCGGCGCCATGAAAGAAGTCATGATCTCGAGATCATGACTTCTTTCATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024804.1-751s1c1
Sequence:CCGGCCTAGCTCACTCAGGATACAACTCGAGTTGTATCCTGAGTGAGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024804.1-1251s1c1
Sequence:CCGGGTTCCCTTTGTAACCATAGAACTCGAGTTCTATGGTTACAAAGGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024804.1-753s21c1
Sequence:CCGGTAGCTCACTCAGGATACAAACCTCGAGGTTTGTATCCTGAGTGAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024804.1-1463s21c1
Sequence:CCGGTGTAGTGACTCAGCCTATAATCTCGAGATTATAGGCTGAGTCACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024804.1-858s21c1
Sequence:GTACCGGACAGTGGAAATCCAGCTTATACTCGAGTATAAGCTGGATTTCCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024804.1-1559s21c1
Sequence:CCGGGTGAAACAACCTGGGCAACATCTCGAGATGTTGCCCAGGTTGTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024804.1-1261s21c1
Sequence:CCGGTAACCATAGAAGTACTCATACCTCGAGGTATGAGTACTTCTATGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks