EMAIL THIS PAGE TO A FRIEND

ZNF66

zinc finger protein 66

Synonyms: ZNF66P
Species: Human ZNF66(7617)
UniProtKB ID: Q6ZN08, I3L4P5, Q15939
Gene ID:
27 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001009883 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001009883 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001009883 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001128444 Rosetta Predictions human pricing
XM_001714861 Rosetta Predictions human pricing
XM_001719758 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001128444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00384915 predicted 456
2 SASI_Hs02_00384916 predicted 1743
3 SASI_Hs02_00384917 predicted 976
4 SASI_Hs02_00384918 predicted 2175
5 SASI_Hs02_00384919 predicted 1866
6 SASI_Hs02_00384920 predicted 2471
7 SASI_Hs02_00384921 predicted 2487
8 SASI_Hs02_00384922 predicted 2514
9 SASI_Hs02_00384923 predicted 2198
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714861 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00399837 predicted 455
2 SASI_Hs02_00399838 predicted 1749
3 SASI_Hs02_00399839 predicted 982
4 SASI_Hs02_00399840 predicted 2174
5 SASI_Hs02_00399841 predicted 1873
6 SASI_Hs02_00399842 predicted 2473
7 SASI_Hs02_00399843 predicted 2486
8 SASI_Hs02_00399844 predicted 2508
9 SASI_Hs02_00399845 predicted 2192
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719758 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00432392 predicted 2198
2 SASI_Hs02_00432393 predicted 2193
3 SASI_Hs02_00432394 predicted 3083
4 SASI_Hs02_00432395 predicted 2176
5 SASI_Hs02_00432396 predicted 2828
6 SASI_Hs02_00432397 predicted 1750
7 SASI_Hs02_00432398 predicted 2888
8 SASI_Hs02_00432399 predicted 1872
9 SASI_Hs02_00432400 predicted 3018
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009883
ZNF66 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 66
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009883.1-2539s1c1
Sequence:CCGGGCAGGAATAAAGATGTTCTTTCTCGAGAAAGAACATCTTTATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009883.1-407s1c1
Sequence:CCGGCCTCAACCTTTACTACACATACTCGAGTATGTGTAGTAAAGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009883.1-575s1c1
Sequence:CCGGCCTCTAACCTTACTACACATACTCGAGTATGTGTAGTAAGGTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009883.1-365s1c1
Sequence:CCGGACCCTTGCAAATTTACAGAATCTCGAGATTCTGTAAATTTGCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009883.1-749s1c1
Sequence:CCGGCCCTTTCTACACATAAGATAACTCGAGTTATCTTATGTGTAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009883
ZNF66 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 66
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009883.1-2539s1c1
Sequence:CCGGGCAGGAATAAAGATGTTCTTTCTCGAGAAAGAACATCTTTATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009883.1-407s1c1
Sequence:CCGGCCTCAACCTTTACTACACATACTCGAGTATGTGTAGTAAAGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009883.1-575s1c1
Sequence:CCGGCCTCTAACCTTACTACACATACTCGAGTATGTGTAGTAAGGTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009883.1-365s1c1
Sequence:CCGGACCCTTGCAAATTTACAGAATCTCGAGATTCTGTAAATTTGCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009883.1-749s1c1
Sequence:CCGGCCCTTTCTACACATAAGATAACTCGAGTTATCTTATGTGTAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009883
ZNF66 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 66
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009883.1-2539s1c1
Sequence:CCGGGCAGGAATAAAGATGTTCTTTCTCGAGAAAGAACATCTTTATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009883.1-407s1c1
Sequence:CCGGCCTCAACCTTTACTACACATACTCGAGTATGTGTAGTAAAGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009883.1-575s1c1
Sequence:CCGGCCTCTAACCTTACTACACATACTCGAGTATGTGTAGTAAGGTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009883.1-365s1c1
Sequence:CCGGACCCTTGCAAATTTACAGAATCTCGAGATTCTGTAAATTTGCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009883.1-749s1c1
Sequence:CCGGCCCTTTCTACACATAAGATAACTCGAGTTATCTTATGTGTAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks