EMAIL THIS PAGE TO A FRIEND

ZNF670

zinc finger protein 670

Species: Human ZNF670(93474)
UniProtKB ID: Q9BS34
Gene ID:
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033213 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033213 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033213 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118831 MISSION® esiRNA esiRNA human ZNF670 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033213 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095634 predicted 789
2 SASI_Hs01_00095635 predicted 664
3 SASI_Hs01_00095636 predicted 448
4 SASI_Hs02_00361008 predicted 664
5 SASI_Hs01_00095638 predicted 367
6 SASI_Hs01_00095639 predicted 960
7 SASI_Hs01_00095640 predicted 645
8 SASI_Hs01_00095641 predicted 850
9 SASI_Hs01_00095642 predicted 579
10 SASI_Hs01_00095643 predicted 1134
11 SASI_Hs01_00095637 predicted 622
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033213
VALIDATED
ZNF670 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 670
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033213.2-418s21c1
Sequence:CCGGACCTTCAGCCAGGATTCAAATCTCGAGATTTGAATCCTGGCTGAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033213.2-574s21c1
Sequence:CCGGGAATGTCCAGAGAAGTTATATCTCGAGATATAACTTCTCTGGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033213.2-391s21c1
Sequence:CCGGATTAAAGAAGGCAGTCAATATCTCGAGATATTGACTGCCTTCTTTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033213.2-1601s21c1
Sequence:CCGGTTATCAGTGGTTCATTGTTAACTCGAGTTAACAATGAACCACTGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_033213.1-1129s1c1
Sequence:CCGGGTAACCTATGTGAGCATGAAACTCGAGTTTCATGCTCACATAGGTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_033213.1-530s1c1
Sequence:CCGGCCTGTCTCACATTGGAAACAACTCGAGTTGTTTCCAATGTGAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_033213.1-1045s1c1
Sequence:CCGGGAGTCCTCAGAGTCCATGAAACTCGAGTTTCATGGACTCTGAGGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_033213.1-1305s1c1
Sequence:CCGGCGAAAGCATGAAAGAGCTTATCTCGAGATAAGCTCTTTCATGCTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_033213.1-886s1c1
Sequence:CCGGGCCAACATGAAAGATCTCATACTCGAGTATGAGATCTTTCATGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033213
VALIDATED
ZNF670 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 670
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033213.2-418s21c1
Sequence:CCGGACCTTCAGCCAGGATTCAAATCTCGAGATTTGAATCCTGGCTGAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033213.2-574s21c1
Sequence:CCGGGAATGTCCAGAGAAGTTATATCTCGAGATATAACTTCTCTGGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033213.2-391s21c1
Sequence:CCGGATTAAAGAAGGCAGTCAATATCTCGAGATATTGACTGCCTTCTTTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033213.2-1601s21c1
Sequence:CCGGTTATCAGTGGTTCATTGTTAACTCGAGTTAACAATGAACCACTGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_033213.1-1129s1c1
Sequence:CCGGGTAACCTATGTGAGCATGAAACTCGAGTTTCATGCTCACATAGGTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_033213.1-530s1c1
Sequence:CCGGCCTGTCTCACATTGGAAACAACTCGAGTTGTTTCCAATGTGAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_033213.1-1045s1c1
Sequence:CCGGGAGTCCTCAGAGTCCATGAAACTCGAGTTTCATGGACTCTGAGGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_033213.1-1305s1c1
Sequence:CCGGCGAAAGCATGAAAGAGCTTATCTCGAGATAAGCTCTTTCATGCTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_033213.1-886s1c1
Sequence:CCGGGCCAACATGAAAGATCTCATACTCGAGTATGAGATCTTTCATGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033213
VALIDATED
ZNF670 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 670
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033213.2-418s21c1
Sequence:CCGGACCTTCAGCCAGGATTCAAATCTCGAGATTTGAATCCTGGCTGAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033213.2-574s21c1
Sequence:CCGGGAATGTCCAGAGAAGTTATATCTCGAGATATAACTTCTCTGGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033213.2-391s21c1
Sequence:CCGGATTAAAGAAGGCAGTCAATATCTCGAGATATTGACTGCCTTCTTTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033213.2-1601s21c1
Sequence:CCGGTTATCAGTGGTTCATTGTTAACTCGAGTTAACAATGAACCACTGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_033213.1-1129s1c1
Sequence:CCGGGTAACCTATGTGAGCATGAAACTCGAGTTTCATGCTCACATAGGTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_033213.1-530s1c1
Sequence:CCGGCCTGTCTCACATTGGAAACAACTCGAGTTGTTTCCAATGTGAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_033213.1-1045s1c1
Sequence:CCGGGAGTCCTCAGAGTCCATGAAACTCGAGTTTCATGGACTCTGAGGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_033213.1-1305s1c1
Sequence:CCGGCGAAAGCATGAAAGAGCTTATCTCGAGATAAGCTCTTTCATGCTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_033213.1-886s1c1
Sequence:CCGGGCCAACATGAAAGATCTCATACTCGAGTATGAGATCTTTCATGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks