EMAIL THIS PAGE TO A FRIEND

ZNF671

zinc finger protein 671

Species: Human ZNF671(79891)
UniProtKB ID: Q8TAW3, A6NF07, Q9H5E9
Gene ID:
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024833 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024833 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024833 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU091141 MISSION® esiRNA esiRNA human ZNF671 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024833 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073331 predicted 1180
2 SASI_Hs01_00073332 predicted 681
3 SASI_Hs02_00357398 predicted 1184
4 SASI_Hs01_00073333 predicted 1316
5 SASI_Hs01_00073334 predicted 1294
6 SASI_Hs01_00073335 predicted 234
7 SASI_Hs01_00073336 predicted 1221
8 SASI_Hs01_00073337 predicted 410
9 SASI_Hs01_00073338 predicted 1403
10 SASI_Hs01_00073339 predicted 396
11 SASI_Hs01_00073340 predicted 934
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024833
VALIDATED
ZNF671 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 671
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_024833.1-1055s1c1
Sequence:CCGGGCCAAAGCTATGACCTCTTTACTCGAGTAAAGAGGTCATAGCTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024833.1-906s1c1
Sequence:CCGGGCTTGTGAGTGGCTTTCTCATCTCGAGATGAGAAAGCCACTCACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_024833.1-265s1c1
Sequence:CCGGCGGGAAGAATGGGAGCTTCTTCTCGAGAAGAAGCTCCCATTCTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024833.1-1430s1c1
Sequence:CCGGGCAGTGATTATGAGTGTAGCACTCGAGTGCTACACTCATAATCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024833.1-597s1c1
Sequence:CCGGCCCAATATTGAAAGATACCTTCTCGAGAAGGTATCTTTCAATATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024833.2-380s21c1
Sequence:CCGGGATCACGTGCAGTCATGAAACCTCGAGGTTTCATGACTGCACGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024833.2-624s21c1
Sequence:CCGGTACCTTACACCTGGCTAAATACTCGAGTATTTAGCCAGGTGTAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024833.2-2112s21c1
Sequence:CCGGCATACTGCGTTTACCATTTACCTCGAGGTAAATGGTAAACGCAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024833.2-1187s21c1
Sequence:CCGGACACGGGTGAAAGACTCTATCCTCGAGGATAGAGTCTTTCACCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024833
VALIDATED
ZNF671 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 671
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_024833.1-1055s1c1
Sequence:CCGGGCCAAAGCTATGACCTCTTTACTCGAGTAAAGAGGTCATAGCTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024833.1-906s1c1
Sequence:CCGGGCTTGTGAGTGGCTTTCTCATCTCGAGATGAGAAAGCCACTCACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_024833.1-265s1c1
Sequence:CCGGCGGGAAGAATGGGAGCTTCTTCTCGAGAAGAAGCTCCCATTCTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024833.1-1430s1c1
Sequence:CCGGGCAGTGATTATGAGTGTAGCACTCGAGTGCTACACTCATAATCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024833.1-597s1c1
Sequence:CCGGCCCAATATTGAAAGATACCTTCTCGAGAAGGTATCTTTCAATATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024833.2-380s21c1
Sequence:CCGGGATCACGTGCAGTCATGAAACCTCGAGGTTTCATGACTGCACGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024833.2-624s21c1
Sequence:CCGGTACCTTACACCTGGCTAAATACTCGAGTATTTAGCCAGGTGTAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024833.2-2112s21c1
Sequence:CCGGCATACTGCGTTTACCATTTACCTCGAGGTAAATGGTAAACGCAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024833.2-1187s21c1
Sequence:CCGGACACGGGTGAAAGACTCTATCCTCGAGGATAGAGTCTTTCACCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024833
VALIDATED
ZNF671 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 671
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_024833.1-1055s1c1
Sequence:CCGGGCCAAAGCTATGACCTCTTTACTCGAGTAAAGAGGTCATAGCTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024833.1-906s1c1
Sequence:CCGGGCTTGTGAGTGGCTTTCTCATCTCGAGATGAGAAAGCCACTCACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_024833.1-265s1c1
Sequence:CCGGCGGGAAGAATGGGAGCTTCTTCTCGAGAAGAAGCTCCCATTCTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024833.1-1430s1c1
Sequence:CCGGGCAGTGATTATGAGTGTAGCACTCGAGTGCTACACTCATAATCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024833.1-597s1c1
Sequence:CCGGCCCAATATTGAAAGATACCTTCTCGAGAAGGTATCTTTCAATATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024833.2-380s21c1
Sequence:CCGGGATCACGTGCAGTCATGAAACCTCGAGGTTTCATGACTGCACGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024833.2-624s21c1
Sequence:CCGGTACCTTACACCTGGCTAAATACTCGAGTATTTAGCCAGGTGTAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024833.2-2112s21c1
Sequence:CCGGCATACTGCGTTTACCATTTACCTCGAGGTAAATGGTAAACGCAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024833.2-1187s21c1
Sequence:CCGGACACGGGTGAAAGACTCTATCCTCGAGGATAGAGTCTTTCACCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks