EMAIL THIS PAGE TO A FRIEND

ZNF672

zinc finger protein 672

UniProtKB ID: Q499Z4, Q96H65, Q96IM3, Q9H6G5
Gene ID:
dog(482699) zinc finger protein 672
domestic cat(101084849) zinc finger protein 672
cow(539058) zinc finger protein 672
sheep(101104149) zinc finger protein 672
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024836 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024836 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024836 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024836 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080695 predicted 2130
2 SASI_Hs01_00080696 predicted 2163
3 SASI_Hs02_00357402 predicted 2063
4 SASI_Hs01_00080697 predicted 722
5 SASI_Hs01_00080698 predicted 2118
6 SASI_Hs01_00080699 predicted 893
7 SASI_Hs02_00357403 predicted 847
8 SASI_Hs01_00080700 predicted 1849
9 SASI_Hs01_00080701 predicted 768
10 SASI_Hs01_00080702 predicted 2255
11 SASI_Hs01_00080703 predicted 1324
12 SASI_Hs01_00080704 predicted 2093
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024836
VALIDATED
ZNF672 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 672
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024836.1-774s21c1
Sequence:CCGGTCAGTGCTGCTGCGACATGAACTCGAGTTCATGTCGCAGCAGCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024836.1-1313s21c1
Sequence:CCGGGTGCTTTGGCAAGAGCTCTACCTCGAGGTAGAGCTCTTGCCAAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024836.1-2344s21c1
Sequence:CCGGGTGTTGGTGTGTCCCTTTAATCTCGAGATTAAAGGGACACACCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024836.1-732s21c1
Sequence:CCGGCCTTACTCGTGCAGCGAATGTCTCGAGACATTCGCTGCACGAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024836.1-907s21c1
Sequence:CCGGTCTGCAGTGAGTGCGGACAAACTCGAGTTTGTCCGCACTCACTGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024836.1-1746s1c1
Sequence:CCGGGTGTCCAATCTCAACGTGCATCTCGAGATGCACGTTGAGATTGGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_024836.1-2033s1c1
Sequence:CCGGGCCAGGGTTCTCTGTGTCCTACTCGAGTAGGACACAGAGAACCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_024836.1-941s1c1
Sequence:CCGGCGGCCGTCTTGACCTACACTTCTCGAGAAGTGTAGGTCAAGACGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024836.1-814s1c1
Sequence:CCGGGCCGCTTCCGTTGCCTAGAATCTCGAGATTCTAGGCAACGGAAGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024836.1-1916s1c1
Sequence:CCGGCCGCTCGCTGTCACAGCATCACTCGAGTGATGCTGTGACAGCGAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024836
VALIDATED
ZNF672 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 672
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024836.1-774s21c1
Sequence:CCGGTCAGTGCTGCTGCGACATGAACTCGAGTTCATGTCGCAGCAGCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024836.1-1313s21c1
Sequence:CCGGGTGCTTTGGCAAGAGCTCTACCTCGAGGTAGAGCTCTTGCCAAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024836.1-2344s21c1
Sequence:CCGGGTGTTGGTGTGTCCCTTTAATCTCGAGATTAAAGGGACACACCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024836.1-732s21c1
Sequence:CCGGCCTTACTCGTGCAGCGAATGTCTCGAGACATTCGCTGCACGAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024836.1-907s21c1
Sequence:CCGGTCTGCAGTGAGTGCGGACAAACTCGAGTTTGTCCGCACTCACTGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024836.1-1746s1c1
Sequence:CCGGGTGTCCAATCTCAACGTGCATCTCGAGATGCACGTTGAGATTGGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_024836.1-2033s1c1
Sequence:CCGGGCCAGGGTTCTCTGTGTCCTACTCGAGTAGGACACAGAGAACCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_024836.1-941s1c1
Sequence:CCGGCGGCCGTCTTGACCTACACTTCTCGAGAAGTGTAGGTCAAGACGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024836.1-814s1c1
Sequence:CCGGGCCGCTTCCGTTGCCTAGAATCTCGAGATTCTAGGCAACGGAAGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024836.1-1916s1c1
Sequence:CCGGCCGCTCGCTGTCACAGCATCACTCGAGTGATGCTGTGACAGCGAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024836
VALIDATED
ZNF672 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 672
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024836.1-774s21c1
Sequence:CCGGTCAGTGCTGCTGCGACATGAACTCGAGTTCATGTCGCAGCAGCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024836.1-1313s21c1
Sequence:CCGGGTGCTTTGGCAAGAGCTCTACCTCGAGGTAGAGCTCTTGCCAAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024836.1-2344s21c1
Sequence:CCGGGTGTTGGTGTGTCCCTTTAATCTCGAGATTAAAGGGACACACCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024836.1-732s21c1
Sequence:CCGGCCTTACTCGTGCAGCGAATGTCTCGAGACATTCGCTGCACGAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024836.1-907s21c1
Sequence:CCGGTCTGCAGTGAGTGCGGACAAACTCGAGTTTGTCCGCACTCACTGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024836.1-1746s1c1
Sequence:CCGGGTGTCCAATCTCAACGTGCATCTCGAGATGCACGTTGAGATTGGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_024836.1-2033s1c1
Sequence:CCGGGCCAGGGTTCTCTGTGTCCTACTCGAGTAGGACACAGAGAACCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_024836.1-941s1c1
Sequence:CCGGCGGCCGTCTTGACCTACACTTCTCGAGAAGTGTAGGTCAAGACGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024836.1-814s1c1
Sequence:CCGGGCCGCTTCCGTTGCCTAGAATCTCGAGATTCTAGGCAACGGAAGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024836.1-1916s1c1
Sequence:CCGGCCGCTCGCTGTCACAGCATCACTCGAGTGATGCTGTGACAGCGAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks