EMAIL THIS PAGE TO A FRIEND

ZNF674

zinc finger protein 674

Synonyms: MRX92 ZNF673B
UniProtKB ID: Q2M3X9, B4DHE2, E9PHQ4
Gene ID:
Human(641339) Summary: This gene encodes a zinc finger protein with an N-terminal Kruppel-associated box-containing (KRAB) domain and 11 Kruppel-type C2H2 zinc finger domains. Like other zinc finger proteins, this gene may function as a transcription factor. This gene resides on an area of chromosome X that has been implicated in nonsyndromic X-linked mental retardation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2010]
cow(514769) zinc finger family member 674
domestic guinea pig(101789031) zinc finger protein 674
Horse(100060244) zinc finger protein 674
dog(491850) zinc finger protein 674
domestic cat(101089334) zinc finger protein 674
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039891 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039891 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039891 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112881 MISSION® esiRNA esiRNA human ZNF674 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039891 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224153 predicted 1353
2 SASI_Hs02_00308713 predicted 2010
3 SASI_Hs01_00224154 predicted 1350
4 SASI_Hs01_00224156 predicted 1084
5 SASI_Hs01_00224157 predicted 1958
6 SASI_Hs01_00224158 predicted 1168
7 SASI_Hs02_00308714 predicted 466
8 SASI_Hs01_00224159 predicted 1452
9 SASI_Hs01_00224160 predicted 1643
10 SASI_Hs01_00224161 predicted 1947
11 SASI_Hs01_00224155 predicted 1359
12 SASI_Hs01_00224162 predicted 2010
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039891
ZNF674 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 674
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039891.1-1235s21c1
Sequence:CCGGACTACGTCCAGCCTTATATATCTCGAGATATATAAGGCTGGACGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039891.1-1314s21c1
Sequence:CCGGAGAAGCCCAGTCCCACTAAACCTCGAGGTTTAGTGGGACTGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039891.1-1961s21c1
Sequence:CCGGTACTTGAGAGTGGGATAATTACTCGAGTAATTATCCCACTCTCAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039891.1-1649s21c1
Sequence:CCGGGAGAAGTCACCACTGATTAAACTCGAGTTTAATCAGTGGTGACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039891.1-1489s21c1
Sequence:CCGGACACCTCTCTGTCCATCATAGCTCGAGCTATGATGGACAGAGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039891
ZNF674 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 674
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039891.1-1235s21c1
Sequence:CCGGACTACGTCCAGCCTTATATATCTCGAGATATATAAGGCTGGACGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039891.1-1314s21c1
Sequence:CCGGAGAAGCCCAGTCCCACTAAACCTCGAGGTTTAGTGGGACTGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039891.1-1961s21c1
Sequence:CCGGTACTTGAGAGTGGGATAATTACTCGAGTAATTATCCCACTCTCAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039891.1-1649s21c1
Sequence:CCGGGAGAAGTCACCACTGATTAAACTCGAGTTTAATCAGTGGTGACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039891.1-1489s21c1
Sequence:CCGGACACCTCTCTGTCCATCATAGCTCGAGCTATGATGGACAGAGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039891
ZNF674 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 674
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039891.1-1235s21c1
Sequence:CCGGACTACGTCCAGCCTTATATATCTCGAGATATATAAGGCTGGACGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039891.1-1314s21c1
Sequence:CCGGAGAAGCCCAGTCCCACTAAACCTCGAGGTTTAGTGGGACTGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039891.1-1961s21c1
Sequence:CCGGTACTTGAGAGTGGGATAATTACTCGAGTAATTATCCCACTCTCAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039891.1-1649s21c1
Sequence:CCGGGAGAAGTCACCACTGATTAAACTCGAGTTTAATCAGTGGTGACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039891.1-1489s21c1
Sequence:CCGGACACCTCTCTGTCCATCATAGCTCGAGCTATGATGGACAGAGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks