EMAIL THIS PAGE TO A FRIEND

ZNF675

zinc finger protein 675

Synonyms: TBZF TIZ
Species: Human ZNF675(171392)
UniProtKB ID: Q8TD23, Q8N211
Gene ID:
13 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV36131 Anti-ZNF675 antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2102934 Anti-ZNF675 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138330 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138330 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138330 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148161 MISSION® esiRNA esiRNA human ZNF675 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138330 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245016 predicted 1872
2 SASI_Hs01_00245014 predicted 834
3 SASI_Hs01_00245017 predicted 1792
4 SASI_Hs01_00245015 predicted 737
5 SASI_Hs01_00245018 predicted 1879
6 SASI_Hs01_00245019 predicted 1865
7 SASI_Hs01_00245020 predicted 1721
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138330
ZNF675 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 675
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138330.2-849s21c1
Sequence:CCGGACTTGTGAGAAACTCTACAAACTCGAGTTTGTAGAGTTTCTCACAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138330.2-1874s21c1
Sequence:CCGGGAACTGGAATGTGTGATAATGCTCGAGCATTATCACACATTCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138330.2-804s21c1
Sequence:CCGGGCTGTTAACCAATCTTCAAAGCTCGAGCTTTGAAGATTGGTTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138330.2-766s21c1
Sequence:CCGGCCAAGGTGAATTTCTGCAAATCTCGAGATTTGCAGAAATTCACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138330.2-651s21c1
Sequence:CCGGTCACATTCAGATAGACATAAGCTCGAGCTTATGTCTATCTGAATGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138330.1-1242s1c1
Sequence:CCGGCGATCCTCAAATCTTACGGAACTCGAGTTCCGTAAGATTTGAGGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138330.1-329s1c1
Sequence:CCGGCCCAGTAATGTGTTCTCATTTCTCGAGAAATGAGAACACATTACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138330.1-1715s1c1
Sequence:CCGGTGAATGTGAGAGATGTGACAACTCGAGTTGTCACATCTCTCACATTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138330
ZNF675 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 675
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138330.2-849s21c1
Sequence:CCGGACTTGTGAGAAACTCTACAAACTCGAGTTTGTAGAGTTTCTCACAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138330.2-1874s21c1
Sequence:CCGGGAACTGGAATGTGTGATAATGCTCGAGCATTATCACACATTCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138330.2-804s21c1
Sequence:CCGGGCTGTTAACCAATCTTCAAAGCTCGAGCTTTGAAGATTGGTTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138330.2-766s21c1
Sequence:CCGGCCAAGGTGAATTTCTGCAAATCTCGAGATTTGCAGAAATTCACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138330.2-651s21c1
Sequence:CCGGTCACATTCAGATAGACATAAGCTCGAGCTTATGTCTATCTGAATGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138330.1-1242s1c1
Sequence:CCGGCGATCCTCAAATCTTACGGAACTCGAGTTCCGTAAGATTTGAGGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138330.1-329s1c1
Sequence:CCGGCCCAGTAATGTGTTCTCATTTCTCGAGAAATGAGAACACATTACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138330.1-1715s1c1
Sequence:CCGGTGAATGTGAGAGATGTGACAACTCGAGTTGTCACATCTCTCACATTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138330
ZNF675 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 675
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138330.2-849s21c1
Sequence:CCGGACTTGTGAGAAACTCTACAAACTCGAGTTTGTAGAGTTTCTCACAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138330.2-1874s21c1
Sequence:CCGGGAACTGGAATGTGTGATAATGCTCGAGCATTATCACACATTCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138330.2-804s21c1
Sequence:CCGGGCTGTTAACCAATCTTCAAAGCTCGAGCTTTGAAGATTGGTTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138330.2-766s21c1
Sequence:CCGGCCAAGGTGAATTTCTGCAAATCTCGAGATTTGCAGAAATTCACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138330.2-651s21c1
Sequence:CCGGTCACATTCAGATAGACATAAGCTCGAGCTTATGTCTATCTGAATGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138330.1-1242s1c1
Sequence:CCGGCGATCCTCAAATCTTACGGAACTCGAGTTCCGTAAGATTTGAGGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138330.1-329s1c1
Sequence:CCGGCCCAGTAATGTGTTCTCATTTCTCGAGAAATGAGAACACATTACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138330.1-1715s1c1
Sequence:CCGGTGAATGTGAGAGATGTGACAACTCGAGTTGTCACATCTCTCACATTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks