EMAIL THIS PAGE TO A FRIEND

ZNF676

zinc finger protein 676

Species: Human ZNF676(163223)
UniProtKB ID: Q8N7Q3, A8MVX5
Gene ID:
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001411 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001411 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001411 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001411 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140754 predicted 2105
2 SASI_Hs01_00140755 predicted 1527
3 SASI_Hs01_00140756 predicted 2035
4 SASI_Hs01_00140757 predicted 2031
5 SASI_Hs01_00140758 predicted 2100
6 SASI_Hs01_00140759 predicted 2121
7 SASI_Hs01_00140760 predicted 1693
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001411
ZNF676 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 676
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001411.1-1381s1c1
Sequence:CCGGGCTGGAGAGAAACACTACAAACTCGAGTTTGTAGTGTTTCTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001411.1-253s1c1
Sequence:CCGGGTAGCGTCTCAACCCTTAATACTCGAGTATTAAGGGTTGAGACGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001411.1-1093s1c1
Sequence:CCGGGCAGATCCTCAAGCCTTACTACTCGAGTAGTAAGGCTTGAGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001411.1-1178s1c1
Sequence:CCGGGTCATCCTCAACTGTTAGTTACTCGAGTAACTAACAGTTGAGGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001411.1-1179s1c1
Sequence:CCGGTCATCCTCAACTGTTAGTTATCTCGAGATAACTAACAGTTGAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001411
ZNF676 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 676
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001411.1-1381s1c1
Sequence:CCGGGCTGGAGAGAAACACTACAAACTCGAGTTTGTAGTGTTTCTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001411.1-253s1c1
Sequence:CCGGGTAGCGTCTCAACCCTTAATACTCGAGTATTAAGGGTTGAGACGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001411.1-1093s1c1
Sequence:CCGGGCAGATCCTCAAGCCTTACTACTCGAGTAGTAAGGCTTGAGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001411.1-1178s1c1
Sequence:CCGGGTCATCCTCAACTGTTAGTTACTCGAGTAACTAACAGTTGAGGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001411.1-1179s1c1
Sequence:CCGGTCATCCTCAACTGTTAGTTATCTCGAGATAACTAACAGTTGAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001411
ZNF676 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 676
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001411.1-1381s1c1
Sequence:CCGGGCTGGAGAGAAACACTACAAACTCGAGTTTGTAGTGTTTCTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001411.1-253s1c1
Sequence:CCGGGTAGCGTCTCAACCCTTAATACTCGAGTATTAAGGGTTGAGACGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001411.1-1093s1c1
Sequence:CCGGGCAGATCCTCAAGCCTTACTACTCGAGTAGTAAGGCTTGAGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001411.1-1178s1c1
Sequence:CCGGGTCATCCTCAACTGTTAGTTACTCGAGTAACTAACAGTTGAGGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001411.1-1179s1c1
Sequence:CCGGTCATCCTCAACTGTTAGTTATCTCGAGATAACTAACAGTTGAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks