EMAIL THIS PAGE TO A FRIEND

ZNF677

zinc finger protein 677

UniProtKB ID: Q86XU0
Gene ID:
Horse(100064162) zinc finger protein 677
cow(525522) zinc finger protein 677
30 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182609 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182609 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182609 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027391 MISSION® esiRNA esiRNA human ZNF677 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182609 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182609 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235366 predicted 747
2 SASI_Hs02_00370747 predicted 1806
3 SASI_Hs01_00235367 predicted 1955
4 SASI_Hs02_00370748 predicted 586
5 SASI_Hs01_00235368 predicted 605
6 SASI_Hs01_00235369 predicted 1964
7 SASI_Hs01_00235370 predicted 624
8 SASI_Hs01_00235372 predicted 1628
9 SASI_Hs01_00235374 predicted 328
10 SASI_Hs01_00235375 predicted 371
11 SASI_Hs01_00235371 predicted 1987
12 SASI_Hs01_00235373 predicted 903
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182609
ZNF677 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 677
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182609.1-475s1c1
Sequence:CCGGCCTGTGGGACTATGATGTAAACTCGAGTTTACATCATAGTCCCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182609.1-1634s1c1
Sequence:CCGGGCCTTTACTGAACGTTCAAATCTCGAGATTTGAACGTTCAGTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182609.1-1811s1c1
Sequence:CCGGCAAAGTTCAAACCTTGGAGATCTCGAGATCTCCAAGGTTTGAACTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182609.1-745s1c1
Sequence:CCGGGCTGGCTGAACTACAGAGATTCTCGAGAATCTCTGTAGTTCAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182609.1-619s1c1
Sequence:CCGGCCAGTATTTCATCCATGACAACTCGAGTTGTCATGGATGAAATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182609.2-1404s21c1
Sequence:CCGGTCACTAGGCATCAGAATATACCTCGAGGTATATTCTGATGCCTAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182609.2-380s21c1
Sequence:CCGGTTATACCATCTGGTGATATTACTCGAGTAATATCACCAGATGGTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182609.2-2221s21c1
Sequence:CCGGTCAGGATACACCATTCATATTCTCGAGAATATGAATGGTGTATCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182609
ZNF677 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 677
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182609.1-475s1c1
Sequence:CCGGCCTGTGGGACTATGATGTAAACTCGAGTTTACATCATAGTCCCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182609.1-1634s1c1
Sequence:CCGGGCCTTTACTGAACGTTCAAATCTCGAGATTTGAACGTTCAGTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182609.1-1811s1c1
Sequence:CCGGCAAAGTTCAAACCTTGGAGATCTCGAGATCTCCAAGGTTTGAACTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182609.1-745s1c1
Sequence:CCGGGCTGGCTGAACTACAGAGATTCTCGAGAATCTCTGTAGTTCAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182609.1-619s1c1
Sequence:CCGGCCAGTATTTCATCCATGACAACTCGAGTTGTCATGGATGAAATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182609.2-1404s21c1
Sequence:CCGGTCACTAGGCATCAGAATATACCTCGAGGTATATTCTGATGCCTAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182609.2-380s21c1
Sequence:CCGGTTATACCATCTGGTGATATTACTCGAGTAATATCACCAGATGGTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182609.2-2221s21c1
Sequence:CCGGTCAGGATACACCATTCATATTCTCGAGAATATGAATGGTGTATCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182609
ZNF677 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 677
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182609.1-475s1c1
Sequence:CCGGCCTGTGGGACTATGATGTAAACTCGAGTTTACATCATAGTCCCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182609.1-1634s1c1
Sequence:CCGGGCCTTTACTGAACGTTCAAATCTCGAGATTTGAACGTTCAGTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182609.1-1811s1c1
Sequence:CCGGCAAAGTTCAAACCTTGGAGATCTCGAGATCTCCAAGGTTTGAACTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182609.1-745s1c1
Sequence:CCGGGCTGGCTGAACTACAGAGATTCTCGAGAATCTCTGTAGTTCAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182609.1-619s1c1
Sequence:CCGGCCAGTATTTCATCCATGACAACTCGAGTTGTCATGGATGAAATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182609.2-1404s21c1
Sequence:CCGGTCACTAGGCATCAGAATATACCTCGAGGTATATTCTGATGCCTAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182609.2-380s21c1
Sequence:CCGGTTATACCATCTGGTGATATTACTCGAGTAATATCACCAGATGGTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182609.2-2221s21c1
Sequence:CCGGTCAGGATACACCATTCATATTCTCGAGAATATGAATGGTGTATCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks