EMAIL THIS PAGE TO A FRIEND

ZNF678

zinc finger protein 678

UniProtKB ID: Q5SXM1, Q8IVQ9
Gene ID:
dog(484331) zinc finger protein 678
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178549 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178549 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178549 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178549 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178549 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369788 predicted 1848
2 SASI_Hs01_00223694 predicted 744
3 SASI_Hs01_00223695 predicted 1174
4 SASI_Hs01_00223696 predicted 1838
5 SASI_Hs01_00223697 predicted 834
6 SASI_Hs01_00223698 predicted 1346
7 SASI_Hs01_00223699 predicted 925
8 SASI_Hs01_00223700 predicted 1976
9 SASI_Hs02_00369789 predicted 1500
10 SASI_Hs02_00369790 predicted 748
11 SASI_Hs01_00223693 predicted 1606
12 SASI_Hs01_00223701 predicted 1247
13 SASI_Hs01_00223702 predicted 926
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178549
ZNF678 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 678
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178549.3-878s21c1
Sequence:CCGGACCCTACAAATGTGATGAATGCTCGAGCATTCATCACATTTGTAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178549.3-1481s21c1
Sequence:CCGGAGAATGTGGCAAAGCGTTTAACTCGAGTTAAACGCTTTGCCACATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178549.2-1847s1c1
Sequence:CCGGCCTCAATCCATAGTAAGTATACTCGAGTATACTTACTATGGATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178549.2-1261s1c1
Sequence:CCGGGCAAGCCTTACTCGTCATAAACTCGAGTTTATGACGAGTAAGGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178549.2-440s1c1
Sequence:CCGGCTTATTCCATTCAAGACCTTTCTCGAGAAAGGTCTTGAATGGAATAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178549.2-840s1c1
Sequence:CCGGGTCACAACTAACTAACCATAACTCGAGTTATGGTTAGTTAGTTGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178549.2-1595s1c1
Sequence:CCGGGCTCTCACCTAACTAGCCATACTCGAGTATGGCTAGTTAGGTGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178549
ZNF678 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 678
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178549.3-878s21c1
Sequence:CCGGACCCTACAAATGTGATGAATGCTCGAGCATTCATCACATTTGTAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178549.3-1481s21c1
Sequence:CCGGAGAATGTGGCAAAGCGTTTAACTCGAGTTAAACGCTTTGCCACATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178549.2-1847s1c1
Sequence:CCGGCCTCAATCCATAGTAAGTATACTCGAGTATACTTACTATGGATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178549.2-1261s1c1
Sequence:CCGGGCAAGCCTTACTCGTCATAAACTCGAGTTTATGACGAGTAAGGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178549.2-440s1c1
Sequence:CCGGCTTATTCCATTCAAGACCTTTCTCGAGAAAGGTCTTGAATGGAATAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178549.2-840s1c1
Sequence:CCGGGTCACAACTAACTAACCATAACTCGAGTTATGGTTAGTTAGTTGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178549.2-1595s1c1
Sequence:CCGGGCTCTCACCTAACTAGCCATACTCGAGTATGGCTAGTTAGGTGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178549
ZNF678 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 678
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178549.3-878s21c1
Sequence:CCGGACCCTACAAATGTGATGAATGCTCGAGCATTCATCACATTTGTAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178549.3-1481s21c1
Sequence:CCGGAGAATGTGGCAAAGCGTTTAACTCGAGTTAAACGCTTTGCCACATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178549.2-1847s1c1
Sequence:CCGGCCTCAATCCATAGTAAGTATACTCGAGTATACTTACTATGGATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178549.2-1261s1c1
Sequence:CCGGGCAAGCCTTACTCGTCATAAACTCGAGTTTATGACGAGTAAGGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178549.2-440s1c1
Sequence:CCGGCTTATTCCATTCAAGACCTTTCTCGAGAAAGGTCTTGAATGGAATAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178549.2-840s1c1
Sequence:CCGGGTCACAACTAACTAACCATAACTCGAGTTATGGTTAGTTAGTTGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178549.2-1595s1c1
Sequence:CCGGGCTCTCACCTAACTAGCCATACTCGAGTATGGCTAGTTAGGTGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks