EMAIL THIS PAGE TO A FRIEND

ZNF679

zinc finger protein 679

UniProtKB ID: Q8IYX0
Gene ID:
cow(540020) zinc finger protein 679
31 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153363 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153363 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153363 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153021 MISSION® esiRNA esiRNA human ZNF679 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153363 Rosetta Predictions human pricing
XR_040973 Rosetta Predictions human pricing
XR_040974 Rosetta Predictions human pricing
XR_040975 Rosetta Predictions human pricing
XR_040976 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153363 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110376 predicted 749
2 SASI_Hs01_00110377 predicted 633
3 SASI_Hs01_00110378 predicted 753
4 SASI_Hs01_00110379 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040973 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00523540 predicted 751
2 SASI_Hs02_00523541 predicted 617
3 SASI_Hs02_00523542 predicted 752
4 SASI_Hs02_00523543 predicted 316
5 SASI_Hs02_00523544 predicted 140
6 SASI_Hs02_00523545 predicted 149
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040974 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00523546 predicted 743
2 SASI_Hs02_00523547 predicted 625
3 SASI_Hs02_00523548 predicted 752
4 SASI_Hs02_00523549 predicted 317
5 SASI_Hs02_00523550 predicted 144
6 SASI_Hs02_00523551 predicted 147
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040975 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00523552 predicted 752
2 SASI_Hs02_00523553 predicted 625
3 SASI_Hs02_00523554 predicted 752
4 SASI_Hs02_00523555 predicted 317
5 SASI_Hs02_00523556 predicted 140
6 SASI_Hs02_00523557 predicted 148
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040976 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00523558 predicted 750
2 SASI_Hs02_00523559 predicted 625
3 SASI_Hs02_00523560 predicted 753
4 SASI_Hs02_00523561 predicted 314
5 SASI_Hs02_00523562 predicted 140
6 SASI_Hs02_00523563 predicted 151
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153363
ZNF679 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 679
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153363.1-936s1c1
Sequence:CCGGCTGCTCTTCAACCCTTTCTAACTCGAGTTAGAAAGGGTTGAAGAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153363.1-862s1c1
Sequence:CCGGCAACTACATCAACATCAGATACTCGAGTATCTGATGTTGATGTAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153363.1-370s1c1
Sequence:CCGGGATCACGCTCAGCAGAATTTACTCGAGTAAATTCTGCTGAGCGTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153363.1-751s1c1
Sequence:CCGGTGTGTCAAAGTCTTCGGCAAACTCGAGTTTGCCGAAGACTTTGACACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153363.1-1361s1c1
Sequence:CCGGCCTCAACTCTTAATACTCATACTCGAGTATGAGTATTAAGAGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153363.2-516s21c1
Sequence:CCGGGTAACCAAACACCCAGTTATGCTCGAGCATAACTGGGTGTTTGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153363.2-560s21c1
Sequence:CCGGTCCGCCAGAGCTAGGCATAAACTCGAGTTTATGCCTAGCTCTGGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153363.2-317s21c1
Sequence:CCGGGACATTCAGAGATGTAGTCATCTCGAGATGACTACATCTCTGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153363.2-1102s21c1
Sequence:CCGGGCCGCTCCTCAACACTTGCTACTCGAGTAGCAAGTGTTGAGGAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153363
ZNF679 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 679
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153363.1-936s1c1
Sequence:CCGGCTGCTCTTCAACCCTTTCTAACTCGAGTTAGAAAGGGTTGAAGAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153363.1-862s1c1
Sequence:CCGGCAACTACATCAACATCAGATACTCGAGTATCTGATGTTGATGTAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153363.1-370s1c1
Sequence:CCGGGATCACGCTCAGCAGAATTTACTCGAGTAAATTCTGCTGAGCGTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153363.1-751s1c1
Sequence:CCGGTGTGTCAAAGTCTTCGGCAAACTCGAGTTTGCCGAAGACTTTGACACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153363.1-1361s1c1
Sequence:CCGGCCTCAACTCTTAATACTCATACTCGAGTATGAGTATTAAGAGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153363.2-516s21c1
Sequence:CCGGGTAACCAAACACCCAGTTATGCTCGAGCATAACTGGGTGTTTGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153363.2-560s21c1
Sequence:CCGGTCCGCCAGAGCTAGGCATAAACTCGAGTTTATGCCTAGCTCTGGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153363.2-317s21c1
Sequence:CCGGGACATTCAGAGATGTAGTCATCTCGAGATGACTACATCTCTGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153363.2-1102s21c1
Sequence:CCGGGCCGCTCCTCAACACTTGCTACTCGAGTAGCAAGTGTTGAGGAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153363
ZNF679 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 679
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153363.1-936s1c1
Sequence:CCGGCTGCTCTTCAACCCTTTCTAACTCGAGTTAGAAAGGGTTGAAGAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153363.1-862s1c1
Sequence:CCGGCAACTACATCAACATCAGATACTCGAGTATCTGATGTTGATGTAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153363.1-370s1c1
Sequence:CCGGGATCACGCTCAGCAGAATTTACTCGAGTAAATTCTGCTGAGCGTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153363.1-751s1c1
Sequence:CCGGTGTGTCAAAGTCTTCGGCAAACTCGAGTTTGCCGAAGACTTTGACACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153363.1-1361s1c1
Sequence:CCGGCCTCAACTCTTAATACTCATACTCGAGTATGAGTATTAAGAGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153363.2-516s21c1
Sequence:CCGGGTAACCAAACACCCAGTTATGCTCGAGCATAACTGGGTGTTTGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153363.2-560s21c1
Sequence:CCGGTCCGCCAGAGCTAGGCATAAACTCGAGTTTATGCCTAGCTCTGGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153363.2-317s21c1
Sequence:CCGGGACATTCAGAGATGTAGTCATCTCGAGATGACTACATCTCTGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153363.2-1102s21c1
Sequence:CCGGGCCGCTCCTCAACACTTGCTACTCGAGTAGCAAGTGTTGAGGAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks