EMAIL THIS PAGE TO A FRIEND

ZNF680

zinc finger protein 680

Species: Human ZNF680(340252)
UniProtKB ID: Q8NEM1, B3KVJ4, Q6ZNF3, Q8NC79
Gene ID:
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178558 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178558 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178558 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001151 MISSION® esiRNA esiRNA targeting human ZNF680 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178558 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145743 predicted 314
2 SASI_Hs01_00145744 predicted 551
3 SASI_Hs01_00145745 predicted 793
4 SASI_Hs01_00145746 predicted 367
5 SASI_Hs01_00145747 predicted 733
6 SASI_Hs01_00145749 predicted 801
7 SASI_Hs01_00145750 predicted 1802
8 SASI_Hs01_00145751 predicted 672
9 SASI_Hs01_00145752 predicted 556
10 SASI_Hs01_00145748 predicted 825
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178558
VALIDATED
ZNF680 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 680
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178558.4-1418s21c1
Sequence:CCGGTAATGGGTGCTCCAGCCTTACCTCGAGGTAAGGCTGGAGCACCCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178558.4-1791s21c1
Sequence:CCGGCATCCTGTTGAGAAACCCTAACTCGAGTTAGGGTTTCTCAACAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178558.4-759s21c1
Sequence:CCGGCATCTAACACAACATATAAGACTCGAGTCTTATATGTTGTGTTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178558.4-1839s21c1
Sequence:CCGGCAATGATTGTTACACTTGCTTCTCGAGAAGCAAGTGTAACAATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178558.4-2151s21c1
Sequence:CCGGGGAGCATAGGAGGGTTGTAGTCTCGAGACTACAACCCTCCTATGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178558.4-820s21c1
Sequence:CCGGGCAAAGTTCTTAACTGGTTCTCTCGAGAGAACCAGTTAAGAACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178558.4-1916s21c1
Sequence:CCGGACTTAACCAATACTCACATCTCTCGAGAGATGTGAGTATTGGTTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178558.4-1827s21c1
Sequence:CCGGGACAAAGCCTTCCAATGATTGCTCGAGCAATCATTGGAAGGCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_178558.2-2434s1c1
Sequence:CCGGGCACTGACACTTTAGACATTACTCGAGTAATGTCTAAAGTGTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178558.2-1576s1c1
Sequence:CCGGGCCTGCAACTCTTGCTAATCACTCGAGTGATTAGCAAGAGTTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178558.2-548s1c1
Sequence:CCGGGAGTCTAAGGTGTTCAAAGAACTCGAGTTCTTTGAACACCTTAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178558.2-331s1c1
Sequence:CCGGGCCTCACCTGATAACCTGTTTCTCGAGAAACAGGTTATCAGGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178558.2-1577s1c1
Sequence:CCGGCCTGCAACTCTTGCTAATCATCTCGAGATGATTAGCAAGAGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178558
VALIDATED
ZNF680 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 680
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178558.4-1418s21c1
Sequence:CCGGTAATGGGTGCTCCAGCCTTACCTCGAGGTAAGGCTGGAGCACCCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178558.4-1791s21c1
Sequence:CCGGCATCCTGTTGAGAAACCCTAACTCGAGTTAGGGTTTCTCAACAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178558.4-759s21c1
Sequence:CCGGCATCTAACACAACATATAAGACTCGAGTCTTATATGTTGTGTTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178558.4-1839s21c1
Sequence:CCGGCAATGATTGTTACACTTGCTTCTCGAGAAGCAAGTGTAACAATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178558.4-2151s21c1
Sequence:CCGGGGAGCATAGGAGGGTTGTAGTCTCGAGACTACAACCCTCCTATGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178558.4-820s21c1
Sequence:CCGGGCAAAGTTCTTAACTGGTTCTCTCGAGAGAACCAGTTAAGAACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178558.4-1916s21c1
Sequence:CCGGACTTAACCAATACTCACATCTCTCGAGAGATGTGAGTATTGGTTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178558.4-1827s21c1
Sequence:CCGGGACAAAGCCTTCCAATGATTGCTCGAGCAATCATTGGAAGGCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_178558.2-2434s1c1
Sequence:CCGGGCACTGACACTTTAGACATTACTCGAGTAATGTCTAAAGTGTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178558.2-1576s1c1
Sequence:CCGGGCCTGCAACTCTTGCTAATCACTCGAGTGATTAGCAAGAGTTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178558.2-548s1c1
Sequence:CCGGGAGTCTAAGGTGTTCAAAGAACTCGAGTTCTTTGAACACCTTAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178558.2-331s1c1
Sequence:CCGGGCCTCACCTGATAACCTGTTTCTCGAGAAACAGGTTATCAGGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178558.2-1577s1c1
Sequence:CCGGCCTGCAACTCTTGCTAATCATCTCGAGATGATTAGCAAGAGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178558
VALIDATED
ZNF680 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 680
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178558.4-1418s21c1
Sequence:CCGGTAATGGGTGCTCCAGCCTTACCTCGAGGTAAGGCTGGAGCACCCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178558.4-1791s21c1
Sequence:CCGGCATCCTGTTGAGAAACCCTAACTCGAGTTAGGGTTTCTCAACAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178558.4-759s21c1
Sequence:CCGGCATCTAACACAACATATAAGACTCGAGTCTTATATGTTGTGTTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178558.4-1839s21c1
Sequence:CCGGCAATGATTGTTACACTTGCTTCTCGAGAAGCAAGTGTAACAATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178558.4-2151s21c1
Sequence:CCGGGGAGCATAGGAGGGTTGTAGTCTCGAGACTACAACCCTCCTATGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178558.4-820s21c1
Sequence:CCGGGCAAAGTTCTTAACTGGTTCTCTCGAGAGAACCAGTTAAGAACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178558.4-1916s21c1
Sequence:CCGGACTTAACCAATACTCACATCTCTCGAGAGATGTGAGTATTGGTTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178558.4-1827s21c1
Sequence:CCGGGACAAAGCCTTCCAATGATTGCTCGAGCAATCATTGGAAGGCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_178558.2-2434s1c1
Sequence:CCGGGCACTGACACTTTAGACATTACTCGAGTAATGTCTAAAGTGTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178558.2-1576s1c1
Sequence:CCGGGCCTGCAACTCTTGCTAATCACTCGAGTGATTAGCAAGAGTTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178558.2-548s1c1
Sequence:CCGGGAGTCTAAGGTGTTCAAAGAACTCGAGTTCTTTGAACACCTTAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178558.2-331s1c1
Sequence:CCGGGCCTCACCTGATAACCTGTTTCTCGAGAAACAGGTTATCAGGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178558.2-1577s1c1
Sequence:CCGGCCTGCAACTCTTGCTAATCATCTCGAGATGATTAGCAAGAGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks