EMAIL THIS PAGE TO A FRIEND

ZNF681

zinc finger protein 681

Species: Human ZNF681(148213)
UniProtKB ID: Q96N22, B3KVF7
Gene ID:
15 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138286 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138286 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138286 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138286 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363369 predicted 1773
2 SASI_Hs01_00197762 predicted 836
3 SASI_Hs01_00197765 predicted 909
4 SASI_Hs02_00363370 predicted 1759
5 SASI_Hs01_00197766 predicted 949
6 SASI_Hs01_00197767 predicted 835
7 SASI_Hs02_00363371 predicted 336
8 SASI_Hs01_00197760 predicted 1484
9 SASI_Hs01_00197761 predicted 552
10 SASI_Hs01_00197763 predicted 560
11 SASI_Hs01_00197764 predicted 613
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138286
ZNF681 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 681
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138286.1-737s1c1
Sequence:CCGGCGTCACACATTACAACACATACTCGAGTATGTGTTGTAATGTGTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138286.1-854s1c1
Sequence:CCGGCCAGAGAGAAACTCAATGAATCTCGAGATTCATTGAGTTTCTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138286.1-1667s1c1
Sequence:CCGGACCTTACTAGACATAAGAGAACTCGAGTTCTCTTATGTCTAGTAAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138286.1-1745s1c1
Sequence:CCGGCCTCAAACCTTACTGGACATACTCGAGTATGTCCAGTAAGGTTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138286.1-1157s1c1
Sequence:CCGGCCTCACACCTTACTAGACATACTCGAGTATGTCTAGTAAGGTGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138286.2-396s21c1
Sequence:CCGGTTTCACCAGAGCAGAACATAACTCGAGTTATGTTCTGCTCTGGTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138286.2-207s21c1
Sequence:CCGGACACTATACAGCAGAATTTATCTCGAGATAAATTCTGCTGTATAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138286.2-2115s21c1
Sequence:CCGGGTCACACTTGATTGTGCATAACTCGAGTTATGCACAATCAAGTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138286.2-2396s21c1
Sequence:CCGGAGACACACATTATGAACATAACTCGAGTTATGTTCATAATGTGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138286
ZNF681 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 681
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138286.1-737s1c1
Sequence:CCGGCGTCACACATTACAACACATACTCGAGTATGTGTTGTAATGTGTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138286.1-854s1c1
Sequence:CCGGCCAGAGAGAAACTCAATGAATCTCGAGATTCATTGAGTTTCTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138286.1-1667s1c1
Sequence:CCGGACCTTACTAGACATAAGAGAACTCGAGTTCTCTTATGTCTAGTAAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138286.1-1745s1c1
Sequence:CCGGCCTCAAACCTTACTGGACATACTCGAGTATGTCCAGTAAGGTTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138286.1-1157s1c1
Sequence:CCGGCCTCACACCTTACTAGACATACTCGAGTATGTCTAGTAAGGTGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138286.2-396s21c1
Sequence:CCGGTTTCACCAGAGCAGAACATAACTCGAGTTATGTTCTGCTCTGGTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138286.2-207s21c1
Sequence:CCGGACACTATACAGCAGAATTTATCTCGAGATAAATTCTGCTGTATAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138286.2-2115s21c1
Sequence:CCGGGTCACACTTGATTGTGCATAACTCGAGTTATGCACAATCAAGTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138286.2-2396s21c1
Sequence:CCGGAGACACACATTATGAACATAACTCGAGTTATGTTCATAATGTGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138286
ZNF681 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 681
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138286.1-737s1c1
Sequence:CCGGCGTCACACATTACAACACATACTCGAGTATGTGTTGTAATGTGTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138286.1-854s1c1
Sequence:CCGGCCAGAGAGAAACTCAATGAATCTCGAGATTCATTGAGTTTCTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138286.1-1667s1c1
Sequence:CCGGACCTTACTAGACATAAGAGAACTCGAGTTCTCTTATGTCTAGTAAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138286.1-1745s1c1
Sequence:CCGGCCTCAAACCTTACTGGACATACTCGAGTATGTCCAGTAAGGTTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138286.1-1157s1c1
Sequence:CCGGCCTCACACCTTACTAGACATACTCGAGTATGTCTAGTAAGGTGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138286.2-396s21c1
Sequence:CCGGTTTCACCAGAGCAGAACATAACTCGAGTTATGTTCTGCTCTGGTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138286.2-207s21c1
Sequence:CCGGACACTATACAGCAGAATTTATCTCGAGATAAATTCTGCTGTATAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138286.2-2115s21c1
Sequence:CCGGGTCACACTTGATTGTGCATAACTCGAGTTATGCACAATCAAGTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138286.2-2396s21c1
Sequence:CCGGAGACACACATTATGAACATAACTCGAGTTATGTTCATAATGTGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks