EMAIL THIS PAGE TO A FRIEND

ZNF682

zinc finger protein 682

Synonyms: BC39498_3
UniProtKB ID: O95780, B3KU64, E9PFJ5, Q96JV9
Gene ID:
dog(484323) zinc finger protein 682
32 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033196 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033196 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033196 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU085211 MISSION® esiRNA esiRNA human ZNF682 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077349 Rosetta Predictions human pricing
NM_033196 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312364 predicted 1552
2 SASI_Hs02_00312365 predicted 1645
3 SASI_Hs02_00312366 predicted 346
4 SASI_Hs02_00312367 predicted 889
5 SASI_Hs02_00312368 predicted 969
6 SASI_Hs02_00312369 predicted 1128
7 SASI_Hs02_00312370 predicted 546
8 SASI_Hs02_00312371 predicted 1424
9 SASI_Hs02_00312372 predicted 302
10 SASI_Hs02_00312373 predicted 1557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360984 predicted 1592
2 SASI_Hs02_00360985 predicted 1692
3 SASI_Hs01_00027586 predicted 385
4 SASI_Hs01_00027587 predicted 930
5 SASI_Hs01_00027588 predicted 1010
6 SASI_Hs01_00027589 predicted 1168
7 SASI_Hs01_00027590 predicted 586
8 SASI_Hs02_00360986 predicted 1462
9 SASI_Hs01_00027591 predicted 349
10 SASI_Hs02_00360987 predicted 1604
11 SASI_Hs01_00027592 predicted 410
12 SASI_Hs01_00027593 predicted 1134
13 SASI_Hs01_00027594 predicted 303
14 SASI_Hs01_00027595 predicted 977
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033196
VALIDATED
ZNF682 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 682
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033196.2-1951s21c1
Sequence:CCGGTAGAGTACACAAGGTGTAATGCTCGAGCATTACACCTTGTGTACTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_033196.2-845s21c1
Sequence:CCGGGCTCGAGTCTTACTAAACATACTCGAGTATGTTTAGTAAGACTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_033196.2-678s21c1
Sequence:CCGGCTCAGGCCTTTCTTATCATAACTCGAGTTATGATAAGAAAGGCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033196.2-1554s21c1
Sequence:CCGGAGAGAAATCCTGCAAGTATAACTCGAGTTATACTTGCAGGATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033196.2-1509s21c1
Sequence:CCGGTAAACGGTGCTCACATCTTAACTCGAGTTAAGATGTGAGCACCGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033196.1-722s1c1
Sequence:CCGGGCTCGAGTCTTACTAAACATACTCGAGTATGTTTAGTAAGACTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033196.1-1343s1c1
Sequence:CCGGCTGCCGTCAAACGCTATAAATCTCGAGATTTATAGCGTTTGACGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033196.1-259s1c1
Sequence:CCGGCCAGAACAGTGCATGCAAGATCTCGAGATCTTGCATGCACTGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033196.1-811s1c1
Sequence:CCGGCCCTTTGTTAGACATAAGAAACTCGAGTTTCTTATGTCTAACAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033196.1-969s1c1
Sequence:CCGGCCACTGCTCACTACTTACTATCTCGAGATAGTAAGTAGTGAGCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033196
VALIDATED
ZNF682 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 682
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033196.2-1951s21c1
Sequence:CCGGTAGAGTACACAAGGTGTAATGCTCGAGCATTACACCTTGTGTACTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_033196.2-845s21c1
Sequence:CCGGGCTCGAGTCTTACTAAACATACTCGAGTATGTTTAGTAAGACTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_033196.2-678s21c1
Sequence:CCGGCTCAGGCCTTTCTTATCATAACTCGAGTTATGATAAGAAAGGCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033196.2-1554s21c1
Sequence:CCGGAGAGAAATCCTGCAAGTATAACTCGAGTTATACTTGCAGGATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033196.2-1509s21c1
Sequence:CCGGTAAACGGTGCTCACATCTTAACTCGAGTTAAGATGTGAGCACCGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033196.1-722s1c1
Sequence:CCGGGCTCGAGTCTTACTAAACATACTCGAGTATGTTTAGTAAGACTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033196.1-1343s1c1
Sequence:CCGGCTGCCGTCAAACGCTATAAATCTCGAGATTTATAGCGTTTGACGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033196.1-259s1c1
Sequence:CCGGCCAGAACAGTGCATGCAAGATCTCGAGATCTTGCATGCACTGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033196.1-811s1c1
Sequence:CCGGCCCTTTGTTAGACATAAGAAACTCGAGTTTCTTATGTCTAACAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033196.1-969s1c1
Sequence:CCGGCCACTGCTCACTACTTACTATCTCGAGATAGTAAGTAGTGAGCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033196
VALIDATED
ZNF682 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 682
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033196.2-1951s21c1
Sequence:CCGGTAGAGTACACAAGGTGTAATGCTCGAGCATTACACCTTGTGTACTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_033196.2-845s21c1
Sequence:CCGGGCTCGAGTCTTACTAAACATACTCGAGTATGTTTAGTAAGACTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_033196.2-678s21c1
Sequence:CCGGCTCAGGCCTTTCTTATCATAACTCGAGTTATGATAAGAAAGGCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033196.2-1554s21c1
Sequence:CCGGAGAGAAATCCTGCAAGTATAACTCGAGTTATACTTGCAGGATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033196.2-1509s21c1
Sequence:CCGGTAAACGGTGCTCACATCTTAACTCGAGTTAAGATGTGAGCACCGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033196.1-722s1c1
Sequence:CCGGGCTCGAGTCTTACTAAACATACTCGAGTATGTTTAGTAAGACTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033196.1-1343s1c1
Sequence:CCGGCTGCCGTCAAACGCTATAAATCTCGAGATTTATAGCGTTTGACGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033196.1-259s1c1
Sequence:CCGGCCAGAACAGTGCATGCAAGATCTCGAGATCTTGCATGCACTGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033196.1-811s1c1
Sequence:CCGGCCCTTTGTTAGACATAAGAAACTCGAGTTTCTTATGTCTAACAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033196.1-969s1c1
Sequence:CCGGCCACTGCTCACTACTTACTATCTCGAGATAGTAAGTAGTGAGCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks