EMAIL THIS PAGE TO A FRIEND

ZNF683

zinc finger protein 683

UniProtKB ID: Q8IZ20, Q5T141, Q5T146, Q5T147, Q5T149, Q8NEN4
Gene ID:
Horse(100071107) zinc finger protein 683
domestic cat(101080308) zinc finger protein 683
dog(487354) zinc finger protein 683
cow(511122) zinc finger protein 683
sheep(101111348) zinc finger protein 683
domestic guinea pig(100715701) zinc finger protein 683
naked mole-rat(101701505) zinc finger protein 683
30 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173574 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173574 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173574 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092961 MISSION® esiRNA esiRNA human ZNF683 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114759 Rosetta Predictions human pricing
NM_173574 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114759 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326824 predicted 423
2 SASI_Hs02_00326825 predicted 1005
3 SASI_Hs02_00326826 predicted 1076
4 SASI_Hs02_00326827 predicted 484
5 SASI_Hs02_00326828 predicted 1178
6 SASI_Hs02_00326829 predicted 688
7 SASI_Hs02_00326830 predicted 465
8 SASI_Hs02_00326831 predicted 1000
9 SASI_Hs02_00326832 predicted 1338
10 SASI_Hs02_00326833 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173574 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111029 predicted 420
2 SASI_Hs01_00111030 predicted 1004
3 SASI_Hs01_00111031 predicted 1076
4 SASI_Hs02_00368415 predicted 479
5 SASI_Hs01_00111032 predicted 1179
6 SASI_Hs01_00111034 predicted 687
7 SASI_Hs01_00111035 predicted 468
8 SASI_Hs01_00111036 predicted 994
9 SASI_Hs01_00111037 predicted 1335
10 SASI_Hs02_00368416 predicted 639
11 SASI_Hs01_00111033 predicted 1266
12 SASI_Hs01_00111038 predicted 719
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173574
ZNF683 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 683
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173574.1-823s1c1
Sequence:CCGGCCTGCTGATGATGGTCAATGACTCGAGTCATTGACCATCATCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173574.1-472s1c1
Sequence:CCGGCGATGACAAGAAATTCACAGTCTCGAGACTGTGAATTTCTTGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173574.1-478s1c1
Sequence:CCGGCAAGAAATTCACAGTCAAGTACTCGAGTACTTGACTGTGAATTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173574.1-1274s1c1
Sequence:CCGGCCAGGAAGAAATCACTGGAAACTCGAGTTTCCAGTGATTTCTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173574.1-1570s1c1
Sequence:CCGGGAAACACATGGGCTATGACATCTCGAGATGTCATAGCCCATGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173574.1-1184s1c1
Sequence:CCGGCAGAAGAGCTTCACTCAACTTCTCGAGAAGTTGAGTGAAGCTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173574.1-505s1c1
Sequence:CCGGGAACAAGGACAAGCTGGGAAACTCGAGTTTCCCAGCTTGTCCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173574.1-1089s1c1
Sequence:CCGGGCAACATATGTGGCAAGAGCTCTCGAGAGCTCTTGCCACATATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173574.1-1563s1c1
Sequence:CCGGCATCTGAGAAACACATGGGCTCTCGAGAGCCCATGTGTTTCTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173574
ZNF683 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 683
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173574.1-823s1c1
Sequence:CCGGCCTGCTGATGATGGTCAATGACTCGAGTCATTGACCATCATCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173574.1-472s1c1
Sequence:CCGGCGATGACAAGAAATTCACAGTCTCGAGACTGTGAATTTCTTGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173574.1-478s1c1
Sequence:CCGGCAAGAAATTCACAGTCAAGTACTCGAGTACTTGACTGTGAATTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173574.1-1274s1c1
Sequence:CCGGCCAGGAAGAAATCACTGGAAACTCGAGTTTCCAGTGATTTCTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173574.1-1570s1c1
Sequence:CCGGGAAACACATGGGCTATGACATCTCGAGATGTCATAGCCCATGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173574.1-1184s1c1
Sequence:CCGGCAGAAGAGCTTCACTCAACTTCTCGAGAAGTTGAGTGAAGCTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173574.1-505s1c1
Sequence:CCGGGAACAAGGACAAGCTGGGAAACTCGAGTTTCCCAGCTTGTCCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173574.1-1089s1c1
Sequence:CCGGGCAACATATGTGGCAAGAGCTCTCGAGAGCTCTTGCCACATATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173574.1-1563s1c1
Sequence:CCGGCATCTGAGAAACACATGGGCTCTCGAGAGCCCATGTGTTTCTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173574
ZNF683 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 683
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173574.1-823s1c1
Sequence:CCGGCCTGCTGATGATGGTCAATGACTCGAGTCATTGACCATCATCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173574.1-472s1c1
Sequence:CCGGCGATGACAAGAAATTCACAGTCTCGAGACTGTGAATTTCTTGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173574.1-478s1c1
Sequence:CCGGCAAGAAATTCACAGTCAAGTACTCGAGTACTTGACTGTGAATTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173574.1-1274s1c1
Sequence:CCGGCCAGGAAGAAATCACTGGAAACTCGAGTTTCCAGTGATTTCTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173574.1-1570s1c1
Sequence:CCGGGAAACACATGGGCTATGACATCTCGAGATGTCATAGCCCATGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173574.1-1184s1c1
Sequence:CCGGCAGAAGAGCTTCACTCAACTTCTCGAGAAGTTGAGTGAAGCTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173574.1-505s1c1
Sequence:CCGGGAACAAGGACAAGCTGGGAAACTCGAGTTTCCCAGCTTGTCCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173574.1-1089s1c1
Sequence:CCGGGCAACATATGTGGCAAGAGCTCTCGAGAGCTCTTGCCACATATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173574.1-1563s1c1
Sequence:CCGGCATCTGAGAAACACATGGGCTCTCGAGAGCCCATGTGTTTCTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks