EMAIL THIS PAGE TO A FRIEND

ZNF684

zinc finger protein 684

UniProtKB ID: Q5T5D7, Q2NKY4
Gene ID:
domestic guinea pig(100726069) zinc finger protein 684
cow(100138535) zinc finger protein 684
sheep(101122402) zinc finger protein 684
Horse(100068068) zinc finger protein 684
dog(482454) zinc finger protein 684
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152373 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152373 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152373 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110351 MISSION® esiRNA esiRNA human ZNF684 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152373 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152373 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153606 predicted 671
2 SASI_Hs01_00153607 predicted 1008
3 SASI_Hs01_00153609 predicted 321
4 SASI_Hs01_00153610 predicted 829
5 SASI_Hs01_00153611 predicted 658
6 SASI_Hs01_00153612 predicted 1372
7 SASI_Hs01_00153613 predicted 657
8 SASI_Hs01_00153614 predicted 591
9 SASI_Hs01_00153615 predicted 484
10 SASI_Hs02_00366023 predicted 380
11 SASI_Hs01_00153608 predicted 765
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152373
ZNF684 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 684
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152373.2-1778s1c1
Sequence:CCGGCCAGTCTCAACATACATAATTCTCGAGAATTATGTATGTTGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152373.2-1148s1c1
Sequence:CCGGCCAGTGTATCATATGTGGCAACTCGAGTTGCCACATATGATACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152373.2-1042s1c1
Sequence:CCGGCTCATACACTTGAGAAGTCATCTCGAGATGACTTCTCAAGTGTATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152373.2-660s1c1
Sequence:CCGGGAGAAGTGTTTGCCACCTAATCTCGAGATTAGGTGGCAAACACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152373.2-524s1c1
Sequence:CCGGGCATCGGGAAAGCAAAGACAACTCGAGTTGTCTTTGCTTTCCCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152373.2-331s21c1
Sequence:CCGGGTGCTGAGAGAACCCTGTATTCTCGAGAATACAGGGTTCTCTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152373.2-1021s21c1
Sequence:CCGGCATTTAATCAACACGTGAAATCTCGAGATTTCACGTGTTGATTAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152373.2-1401s21c1
Sequence:CCGGGAATATGAGAAGGCCTTATTACTCGAGTAATAAGGCCTTCTCATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152373.2-526s21c1
Sequence:GTACCGGATCGGGAAAGCAAAGACAATTCTCGAGAATTGTCTTTGCTTTCCCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152373.2-662s21c1
Sequence:GTACCGGGAAGTGTTTGCCACCTAATTTCTCGAGAAATTAGGTGGCAAACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152373
ZNF684 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 684
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152373.2-1778s1c1
Sequence:CCGGCCAGTCTCAACATACATAATTCTCGAGAATTATGTATGTTGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152373.2-1148s1c1
Sequence:CCGGCCAGTGTATCATATGTGGCAACTCGAGTTGCCACATATGATACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152373.2-1042s1c1
Sequence:CCGGCTCATACACTTGAGAAGTCATCTCGAGATGACTTCTCAAGTGTATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152373.2-660s1c1
Sequence:CCGGGAGAAGTGTTTGCCACCTAATCTCGAGATTAGGTGGCAAACACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152373.2-524s1c1
Sequence:CCGGGCATCGGGAAAGCAAAGACAACTCGAGTTGTCTTTGCTTTCCCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152373.2-331s21c1
Sequence:CCGGGTGCTGAGAGAACCCTGTATTCTCGAGAATACAGGGTTCTCTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152373.2-1021s21c1
Sequence:CCGGCATTTAATCAACACGTGAAATCTCGAGATTTCACGTGTTGATTAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152373.2-1401s21c1
Sequence:CCGGGAATATGAGAAGGCCTTATTACTCGAGTAATAAGGCCTTCTCATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152373.2-526s21c1
Sequence:GTACCGGATCGGGAAAGCAAAGACAATTCTCGAGAATTGTCTTTGCTTTCCCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152373.2-662s21c1
Sequence:GTACCGGGAAGTGTTTGCCACCTAATTTCTCGAGAAATTAGGTGGCAAACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152373
ZNF684 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 684
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152373.2-1778s1c1
Sequence:CCGGCCAGTCTCAACATACATAATTCTCGAGAATTATGTATGTTGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152373.2-1148s1c1
Sequence:CCGGCCAGTGTATCATATGTGGCAACTCGAGTTGCCACATATGATACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152373.2-1042s1c1
Sequence:CCGGCTCATACACTTGAGAAGTCATCTCGAGATGACTTCTCAAGTGTATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152373.2-660s1c1
Sequence:CCGGGAGAAGTGTTTGCCACCTAATCTCGAGATTAGGTGGCAAACACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152373.2-524s1c1
Sequence:CCGGGCATCGGGAAAGCAAAGACAACTCGAGTTGTCTTTGCTTTCCCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152373.2-331s21c1
Sequence:CCGGGTGCTGAGAGAACCCTGTATTCTCGAGAATACAGGGTTCTCTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152373.2-1021s21c1
Sequence:CCGGCATTTAATCAACACGTGAAATCTCGAGATTTCACGTGTTGATTAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152373.2-1401s21c1
Sequence:CCGGGAATATGAGAAGGCCTTATTACTCGAGTAATAAGGCCTTCTCATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152373.2-526s21c1
Sequence:GTACCGGATCGGGAAAGCAAAGACAATTCTCGAGAATTGTCTTTGCTTTCCCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152373.2-662s21c1
Sequence:GTACCGGGAAGTGTTTGCCACCTAATTTCTCGAGAAATTAGGTGGCAAACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks