EMAIL THIS PAGE TO A FRIEND

ZNF687

zinc finger protein 687

UniProtKB ID: Q8N1G0, D3DV17, Q68DQ8, Q9H937, Q9P2A7
Gene ID:
chicken(429831) zinc finger protein 687
dog(483195) zinc finger protein 687
Horse(100059692) zinc finger protein 687
domestic cat(101098811) zinc finger protein 687
cow(787675) zinc finger protein 687
sheep(101114989) zinc finger protein 687
domestic guinea pig(100716125) zinc finger protein 687
naked mole-rat(101698646) zinc finger protein 687
Domestic Rabbit(100328670) zinc finger protein 687
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020832 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020832 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020832 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157541 MISSION® esiRNA esiRNA human ZNF687 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020832 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020832 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116660 predicted 1070
2 SASI_Hs02_00354072 predicted 3129
3 SASI_Hs02_00354073 predicted 2313
4 SASI_Hs01_00116662 predicted 2661
5 SASI_Hs01_00116663 predicted 3170
6 SASI_Hs01_00116664 predicted 1242
7 SASI_Hs01_00116665 predicted 1269
8 SASI_Hs01_00116666 predicted 1230
9 SASI_Hs01_00116668 predicted 453
10 SASI_Hs01_00116669 predicted 338
11 SASI_Hs01_00116661 predicted 3732
12 SASI_Hs01_00116667 predicted 1147
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020832
VALIDATED
ZNF687 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 687
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020832.1-4036s21c1
Sequence:CCGGTCTGAGCCCAACACTAATTAACTCGAGTTAATTAGTGTTGGGCTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020832.1-1509s21c1
Sequence:CCGGGTGATGGTGCAACCTTCAAAGCTCGAGCTTTGAAGGTTGCACCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020832.1-2015s21c1
Sequence:CCGGCATCACCTCCTCTGCCATTACCTCGAGGTAATGGCAGAGGAGGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020832.1-2318s21c1
Sequence:CCGGCAACTTCCTGCAAGCCAATTTCTCGAGAAATTGGCTTGCAGGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020832.1-1621s21c1
Sequence:CCGGAGAACCTGCTCCCTGCCTATACTCGAGTATAGGCAGGGAGCAGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020832.1-1086s21c1
Sequence:CCGGGTGCGGATCAAGACCATTAAACTCGAGTTTAATGGTCTTGATCCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020832.1-3011s21c1
Sequence:CCGGGTTCCCTGAGCGTGATGAATACTCGAGTATTCATCACGCTCAGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005687    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020832.1-3945s1c1
Sequence:CCGGGAAGAGCATTTGAGGATTATTCTCGAGAATAATCCTCAAATGCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020832.1-141s1c1
Sequence:CCGGGCCTTTGACATCCCTGACATTCTCGAGAATGTCAGGGATGTCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020832.1-1868s1c1
Sequence:CCGGCGTCATGCAGTGCTCACATTTCTCGAGAAATGTGAGCACTGCATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020832.1-2594s1c1
Sequence:CCGGCGACACAGTCTTCACTCACAACTCGAGTTGTGAGTGAAGACTGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020832.1-1397s1c1
Sequence:CCGGCCCTAAGATGATTGCTAAGAACTCGAGTTCTTAGCAATCATCTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020832
VALIDATED
ZNF687 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 687
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020832.1-4036s21c1
Sequence:CCGGTCTGAGCCCAACACTAATTAACTCGAGTTAATTAGTGTTGGGCTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020832.1-1509s21c1
Sequence:CCGGGTGATGGTGCAACCTTCAAAGCTCGAGCTTTGAAGGTTGCACCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020832.1-2015s21c1
Sequence:CCGGCATCACCTCCTCTGCCATTACCTCGAGGTAATGGCAGAGGAGGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020832.1-2318s21c1
Sequence:CCGGCAACTTCCTGCAAGCCAATTTCTCGAGAAATTGGCTTGCAGGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020832.1-1621s21c1
Sequence:CCGGAGAACCTGCTCCCTGCCTATACTCGAGTATAGGCAGGGAGCAGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020832.1-1086s21c1
Sequence:CCGGGTGCGGATCAAGACCATTAAACTCGAGTTTAATGGTCTTGATCCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020832.1-3011s21c1
Sequence:CCGGGTTCCCTGAGCGTGATGAATACTCGAGTATTCATCACGCTCAGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005687    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020832.1-3945s1c1
Sequence:CCGGGAAGAGCATTTGAGGATTATTCTCGAGAATAATCCTCAAATGCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020832.1-141s1c1
Sequence:CCGGGCCTTTGACATCCCTGACATTCTCGAGAATGTCAGGGATGTCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020832.1-1868s1c1
Sequence:CCGGCGTCATGCAGTGCTCACATTTCTCGAGAAATGTGAGCACTGCATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020832.1-2594s1c1
Sequence:CCGGCGACACAGTCTTCACTCACAACTCGAGTTGTGAGTGAAGACTGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020832.1-1397s1c1
Sequence:CCGGCCCTAAGATGATTGCTAAGAACTCGAGTTCTTAGCAATCATCTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020832
VALIDATED
ZNF687 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 687
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020832.1-4036s21c1
Sequence:CCGGTCTGAGCCCAACACTAATTAACTCGAGTTAATTAGTGTTGGGCTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020832.1-1509s21c1
Sequence:CCGGGTGATGGTGCAACCTTCAAAGCTCGAGCTTTGAAGGTTGCACCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020832.1-2015s21c1
Sequence:CCGGCATCACCTCCTCTGCCATTACCTCGAGGTAATGGCAGAGGAGGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020832.1-2318s21c1
Sequence:CCGGCAACTTCCTGCAAGCCAATTTCTCGAGAAATTGGCTTGCAGGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020832.1-1621s21c1
Sequence:CCGGAGAACCTGCTCCCTGCCTATACTCGAGTATAGGCAGGGAGCAGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020832.1-1086s21c1
Sequence:CCGGGTGCGGATCAAGACCATTAAACTCGAGTTTAATGGTCTTGATCCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020832.1-3011s21c1
Sequence:CCGGGTTCCCTGAGCGTGATGAATACTCGAGTATTCATCACGCTCAGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005687    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020832.1-3945s1c1
Sequence:CCGGGAAGAGCATTTGAGGATTATTCTCGAGAATAATCCTCAAATGCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020832.1-141s1c1
Sequence:CCGGGCCTTTGACATCCCTGACATTCTCGAGAATGTCAGGGATGTCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020832.1-1868s1c1
Sequence:CCGGCGTCATGCAGTGCTCACATTTCTCGAGAAATGTGAGCACTGCATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020832.1-2594s1c1
Sequence:CCGGCGACACAGTCTTCACTCACAACTCGAGTTGTGAGTGAAGACTGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020832.1-1397s1c1
Sequence:CCGGCCCTAAGATGATTGCTAAGAACTCGAGTTCTTAGCAATCATCTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks