EMAIL THIS PAGE TO A FRIEND

ZNF688

zinc finger protein 688

Gene ID:
naked mole-rat(101696545) zinc finger protein 688
domestic guinea pig(100713600) zinc finger protein 688
cow(786784) zinc finger protein 688
sheep(101103449) zinc finger protein 688
dog(489908) zinc finger protein 688
domestic cat(101093568) zinc finger protein 688
31 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145271 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145271 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145271 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024683 Rosetta Predictions human pricing
NM_145271 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024683 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307242 predicted 526
2 SASI_Hs01_00136804 predicted 630
3 SASI_Hs01_00136805 predicted 498
4 SASI_Hs01_00136807 predicted 592
5 SASI_Hs01_00136808 predicted 881
6 SASI_Hs01_00136809 predicted 883
7 SASI_Hs01_00136810 predicted 857
8 SASI_Hs01_00136811 predicted 886
9 SASI_Hs01_00136812 predicted 760
10 SASI_Hs01_00136813 predicted 631
11 SASI_Hs01_00136806 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145271 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365143 predicted 1423
2 SASI_Hs01_00121971 predicted 1313
3 SASI_Hs01_00121972 predicted 1190
4 SASI_Hs01_00121974 predicted 1285
5 SASI_Hs01_00121975 predicted 1565
6 SASI_Hs01_00121976 predicted 1573
7 SASI_Hs01_00121977 predicted 1548
8 SASI_Hs01_00121978 predicted 1583
9 SASI_Hs01_00121979 predicted 1449
10 SASI_Hs01_00121980 predicted 1318
11 SASI_Hs01_00121973 predicted 1548
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145271
ZNF688 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 688
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145271.3-1622s1c1
Sequence:CCGGGCTGGAGTTGAGCCTGACCTTCTCGAGAAGGTCAGGCTCAACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145271.3-1091s1c1
Sequence:CCGGGATGTCCCAAACAGGAAGGAACTCGAGTTCCTTCCTGTTTGGGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145271.3-1154s1c1
Sequence:CCGGGCTCCTGTGAAGGAGAGTCCTCTCGAGAGGACTCTCCTTCACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145271.3-1283s1c1
Sequence:CCGGGCACCCATACCCAGCATGGATCTCGAGATCCATGCTGGGTATGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145271.3-1573s1c1
Sequence:CCGGCCGGCACTACCCAGACATCTTCTCGAGAAGATGTCTGGGTAGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145271.3-1581s21c1
Sequence:CCGGACCCAGACATCTTCGAGGAGTCTCGAGACTCCTCGAAGATGTCTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145271.3-1174s21c1
Sequence:CCGGTGAAGTGCTGGTGGAACGCAACTCGAGTTGCGTTCCACCAGCACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145271.3-1133s21c1
Sequence:CCGGAGAGCCAAAGGGCCTAGAAAGCTCGAGCTTTCTAGGCCCTTTGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145271.3-1122s21c1
Sequence:CCGGAGGAAGTCCCAAGAGCCAAAGCTCGAGCTTTGGCTCTTGGGACTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145271.3-1688s21c1
Sequence:CCGGGACTCCGGAACTGAAATTCATCTCGAGATGAATTTCAGTTCCGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145271.3-1081s21c1
Sequence:CCGGTCGGAGAGGAGATGTCCCAAACTCGAGTTTGGGACATCTCCTCTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145271
ZNF688 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 688
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145271.3-1622s1c1
Sequence:CCGGGCTGGAGTTGAGCCTGACCTTCTCGAGAAGGTCAGGCTCAACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145271.3-1091s1c1
Sequence:CCGGGATGTCCCAAACAGGAAGGAACTCGAGTTCCTTCCTGTTTGGGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145271.3-1154s1c1
Sequence:CCGGGCTCCTGTGAAGGAGAGTCCTCTCGAGAGGACTCTCCTTCACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145271.3-1283s1c1
Sequence:CCGGGCACCCATACCCAGCATGGATCTCGAGATCCATGCTGGGTATGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145271.3-1573s1c1
Sequence:CCGGCCGGCACTACCCAGACATCTTCTCGAGAAGATGTCTGGGTAGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145271.3-1581s21c1
Sequence:CCGGACCCAGACATCTTCGAGGAGTCTCGAGACTCCTCGAAGATGTCTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145271.3-1174s21c1
Sequence:CCGGTGAAGTGCTGGTGGAACGCAACTCGAGTTGCGTTCCACCAGCACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145271.3-1133s21c1
Sequence:CCGGAGAGCCAAAGGGCCTAGAAAGCTCGAGCTTTCTAGGCCCTTTGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145271.3-1122s21c1
Sequence:CCGGAGGAAGTCCCAAGAGCCAAAGCTCGAGCTTTGGCTCTTGGGACTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145271.3-1688s21c1
Sequence:CCGGGACTCCGGAACTGAAATTCATCTCGAGATGAATTTCAGTTCCGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145271.3-1081s21c1
Sequence:CCGGTCGGAGAGGAGATGTCCCAAACTCGAGTTTGGGACATCTCCTCTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145271
ZNF688 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 688
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145271.3-1622s1c1
Sequence:CCGGGCTGGAGTTGAGCCTGACCTTCTCGAGAAGGTCAGGCTCAACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145271.3-1091s1c1
Sequence:CCGGGATGTCCCAAACAGGAAGGAACTCGAGTTCCTTCCTGTTTGGGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145271.3-1154s1c1
Sequence:CCGGGCTCCTGTGAAGGAGAGTCCTCTCGAGAGGACTCTCCTTCACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145271.3-1283s1c1
Sequence:CCGGGCACCCATACCCAGCATGGATCTCGAGATCCATGCTGGGTATGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145271.3-1573s1c1
Sequence:CCGGCCGGCACTACCCAGACATCTTCTCGAGAAGATGTCTGGGTAGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145271.3-1581s21c1
Sequence:CCGGACCCAGACATCTTCGAGGAGTCTCGAGACTCCTCGAAGATGTCTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145271.3-1174s21c1
Sequence:CCGGTGAAGTGCTGGTGGAACGCAACTCGAGTTGCGTTCCACCAGCACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145271.3-1133s21c1
Sequence:CCGGAGAGCCAAAGGGCCTAGAAAGCTCGAGCTTTCTAGGCCCTTTGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145271.3-1122s21c1
Sequence:CCGGAGGAAGTCCCAAGAGCCAAAGCTCGAGCTTTGGCTCTTGGGACTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145271.3-1688s21c1
Sequence:CCGGGACTCCGGAACTGAAATTCATCTCGAGATGAATTTCAGTTCCGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145271.3-1081s21c1
Sequence:CCGGTCGGAGAGGAGATGTCCCAAACTCGAGTTTGGGACATCTCCTCTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks